ID: 927517280

View in Genome Browser
Species Human (GRCh38)
Location 2:23679862-23679884
Sequence CTGCTTGGCCAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 350}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927517276_927517280 -2 Left 927517276 2:23679841-23679863 CCTGGTGGTGAAGGATAAATACT 0: 1
1: 0
2: 0
3: 13
4: 175
Right 927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG 0: 1
1: 0
2: 2
3: 25
4: 350
927517275_927517280 -1 Left 927517275 2:23679840-23679862 CCCTGGTGGTGAAGGATAAATAC 0: 1
1: 0
2: 0
3: 14
4: 119
Right 927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG 0: 1
1: 0
2: 2
3: 25
4: 350
927517271_927517280 19 Left 927517271 2:23679820-23679842 CCAGGACAAAATAACACTTTCCC 0: 1
1: 0
2: 1
3: 25
4: 174
Right 927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG 0: 1
1: 0
2: 2
3: 25
4: 350
927517270_927517280 20 Left 927517270 2:23679819-23679841 CCCAGGACAAAATAACACTTTCC 0: 1
1: 0
2: 0
3: 25
4: 209
Right 927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG 0: 1
1: 0
2: 2
3: 25
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927517280 Original CRISPR CTGCTTGGCCAGATGGAGGA AGG Intronic
900495306 1:2973414-2973436 GTGCTGGGGCAGAGGGAGGAGGG + Intergenic
900787198 1:4656162-4656184 CTCCAGGGCCAGATGGAAGAGGG + Intronic
900896422 1:5486100-5486122 CTGCTTGGACAGGTGAAGGCTGG - Intergenic
901116212 1:6846982-6847004 CTGCTTGAGCACATGAAGGATGG + Intronic
901345701 1:8539687-8539709 ATGCTTGGCCAGGTGTAGGTGGG - Intronic
901444105 1:9296804-9296826 TTGCTTGGACAAAGGGAGGATGG + Intronic
902331784 1:15734460-15734482 CTGCCTCGCCAGATGCAGGGGGG + Exonic
902416773 1:16244383-16244405 CAGGTAGGCCAGCTGGAGGATGG + Intergenic
902506029 1:16939390-16939412 GTGCTTGGGCAGCTGGTGGAGGG + Intronic
902526772 1:17063979-17064001 CTGCATGTCCAGCTGGAGAAGGG + Intergenic
903155011 1:21437049-21437071 GTGCTTGGGCAGCTGGTGGAAGG + Intergenic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903261230 1:22132787-22132809 CTGCTGTGCCAGATGAAGGCAGG - Intronic
903684871 1:25123639-25123661 CTGCTTATCCACAGGGAGGAGGG - Intergenic
904418012 1:30374624-30374646 CTTCTTGGCCTGGTGGTGGAAGG + Intergenic
904453197 1:30629853-30629875 GTTCTTGGCCAGATGGGGCACGG - Intergenic
906223695 1:44103682-44103704 CTGCTTGGCCGGCTGGAGGGCGG + Intergenic
906607332 1:47181421-47181443 CAGCCTGGCCAGATCGGGGAGGG - Intergenic
907814034 1:57900634-57900656 CTGGTTGGCCACATGGACAAAGG - Intronic
908092010 1:60696261-60696283 CTGGTTGGCCAAATGGAAGCAGG - Intergenic
912589561 1:110802494-110802516 CTGCTTGTCCAGAATGAGGGAGG - Intergenic
915313020 1:155013829-155013851 CTCCTTGGCCCCATGGGGGAGGG + Intronic
915347211 1:155203593-155203615 CTGGTTGGTGAGAAGGAGGAAGG + Intronic
915619819 1:157074325-157074347 CTGCTTGGCCCGCTGCAGGGCGG - Intergenic
917447087 1:175115504-175115526 CTGCTTGGCCCCATGGGGAAAGG + Intronic
918078022 1:181185159-181185181 ATGCTTGGTCCGGTGGAGGAAGG - Intergenic
918218651 1:182415650-182415672 CTGCCTGGTCAGAGGGAGGAGGG + Intergenic
919807844 1:201391278-201391300 CTGCTTGGCCCCATGAATGAAGG - Intronic
919844142 1:201630402-201630424 CAGCTTGGCCCGCTGGAGCAGGG - Intronic
920031851 1:203042275-203042297 ATGCTTGTCCTGATGGGGGAGGG + Intronic
920533564 1:206722851-206722873 CTGCTGCACCACATGGAGGATGG - Intronic
920977718 1:210801474-210801496 GTGCTGGTCCAGATGGAAGAGGG - Intronic
922417825 1:225437902-225437924 CTCCATGGCCAGAAGGTGGAAGG - Intergenic
922541095 1:226420530-226420552 CTGCTGGGCCAGTGTGAGGAAGG - Intergenic
922636892 1:227182787-227182809 CTGCTTGCCCACATTGAGGGTGG - Intronic
923836735 1:237618970-237618992 CTTCTTGGACATCTGGAGGAGGG - Intronic
1063034894 10:2276664-2276686 CTGCTTCTCCAGATGGAAGGCGG + Intergenic
1067208334 10:44238495-44238517 CTCCTGGGCCAGTTGAAGGAGGG + Intergenic
1067577747 10:47418868-47418890 CTGCTGGCCCAAATGGAGGATGG + Intergenic
1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG + Intronic
1069962589 10:72087547-72087569 CTTCTAGGCGAGATGGTGGAAGG - Intronic
1071465911 10:85939528-85939550 CTGATTGTGAAGATGGAGGAAGG - Intronic
1073300064 10:102465747-102465769 CTGCTGGGGCAGATTGAGGGTGG + Intronic
1073314505 10:102569504-102569526 CTGCTTGGAGAGATAGAGAAGGG - Intronic
1073512431 10:104051209-104051231 GTGCTTGCTCAGATGGAGGCAGG + Intronic
1074094787 10:110301997-110302019 CTTCTTGGGCAGTGGGAGGAGGG - Intronic
1074205931 10:111282659-111282681 CTGCTTGGCTCAAAGGAGGAGGG - Intergenic
1074498408 10:114000309-114000331 CTTCTTGCCTAGATAGAGGAGGG - Intergenic
1075566229 10:123506440-123506462 CTGCATGGGAAGATGCAGGAAGG - Intergenic
1076457609 10:130611582-130611604 CTGCCTGGCCACATAAAGGAGGG + Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077368758 11:2171912-2171934 CTGCTGTGCCTGATGGAGGCGGG + Intergenic
1077392612 11:2307085-2307107 CTGCAAGGCCTGATGGGGGATGG - Intronic
1077730323 11:4723091-4723113 CTGCTTGGCCCGCTGCAGGGCGG + Intronic
1079419456 11:20272477-20272499 GAGCTTGGCCAGGGGGAGGAAGG - Intergenic
1080526650 11:33128963-33128985 CTGCATGGGAAGATGGGGGATGG - Intronic
1081556316 11:44165309-44165331 CTGCTTGTCCACAGAGAGGAAGG - Intronic
1081757346 11:45554161-45554183 AAGCTTGACCATATGGAGGAGGG + Intergenic
1081811326 11:45915699-45915721 CTACTTGGCCAGCTGGACGAGGG + Exonic
1082024862 11:47564949-47564971 CTGTTTGGTCAGATGAAGGAGGG + Intronic
1082772261 11:57217205-57217227 CTGCTTCCCCAGGAGGAGGAAGG - Intergenic
1083160911 11:60853571-60853593 CTGCTGGGCCTGGTGGAGAATGG - Exonic
1083299476 11:61732801-61732823 CAGCCTGGCCAGAGGGAGAAGGG + Intronic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083664552 11:64267422-64267444 CTGCTGGGCGAGATGCCGGAGGG + Exonic
1083813840 11:65120795-65120817 CTGTTTGGCCACCTGGAGAAGGG + Exonic
1084144571 11:67257532-67257554 GTGCTTGGAAAGATGGAGGCAGG - Exonic
1084459010 11:69285934-69285956 CTGCTAGGCCAGACTGAGGCAGG - Intergenic
1086290514 11:85303900-85303922 CTCCTTGACCAGATAGAAGAAGG + Intronic
1086473121 11:87138732-87138754 TTGCTTGGACAAATGGTGGATGG + Intronic
1089676079 11:120090602-120090624 CTGCCTGGCAAGATGGAGTATGG - Intergenic
1090248903 11:125237381-125237403 CTCCTTGGAGAGATGGAGAAGGG - Intronic
1090387583 11:126365711-126365733 CTGGTGGGGCAGCTGGAGGAAGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090713185 11:129406583-129406605 GTGCTTGGGGAGGTGGAGGAGGG + Intronic
1090945059 11:131422101-131422123 CTACTTTGCCTGATGGAGGAAGG + Intronic
1091283479 11:134395426-134395448 CTGCTTGGCCGAGTGGAGGAAGG + Intronic
1091840488 12:3616950-3616972 TTACCTGGCCAGATGGAGCAGGG + Exonic
1092705859 12:11283657-11283679 CTGCTTGATCAGTTGGATGAGGG + Intergenic
1092930020 12:13307072-13307094 CTTCTTGGCCTGAGGGTGGAGGG + Intergenic
1092946479 12:13458683-13458705 CAGCTTGGCCTGATGGAGCCAGG - Intergenic
1093747525 12:22760040-22760062 CTGCTTTGCCAGGTTGAGAACGG - Intergenic
1095521788 12:43075344-43075366 CTGCCTGTCCTGATGGAGAAGGG - Intergenic
1095737812 12:45576753-45576775 CTACTTGCCCAGATACAGGAGGG + Intergenic
1096518721 12:52172305-52172327 CTGCTTGGCCTGCTGCAGGGCGG + Exonic
1096626428 12:52898786-52898808 CTGCTTGGCCCGCTGCAGGGCGG + Exonic
1096874589 12:54617396-54617418 CTGCTTGGCTTGAGGGTGGAGGG + Intergenic
1096985254 12:55751891-55751913 CCCCTTGGCCAGTTGGTGGAAGG + Exonic
1099923252 12:88985278-88985300 CTGCTTTGCCATAAGGAGGTAGG - Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104646612 12:130502086-130502108 CTGTCTTGCCTGATGGAGGAGGG + Intronic
1105818114 13:24055415-24055437 CTGCCTAGGGAGATGGAGGATGG + Intronic
1106273815 13:28183442-28183464 CCGCTTGTCAAGATGGAGGAGGG + Intronic
1106764931 13:32904037-32904059 CTGCTGGTCCAGAAGTAGGAGGG + Intergenic
1110279714 13:73678910-73678932 CTTCTTGGCTAGATGGATGATGG + Intergenic
1113175988 13:107564678-107564700 TTTCTTGGACAGAGGGAGGAAGG - Intronic
1113427451 13:110220856-110220878 AGGCTTGGCCATACGGAGGAAGG - Intronic
1113748593 13:112763326-112763348 CTGCTGGTCCAAAGGGAGGAGGG - Intronic
1114332559 14:21652128-21652150 CTGCTGGGCCAGCTGGGAGAGGG + Intergenic
1114613008 14:24054327-24054349 CTACTGGGCCAGCTGGAGGAGGG + Intronic
1115855160 14:37622655-37622677 CTGCATGGCCAAAGAGAGGAAGG + Intronic
1116596543 14:46855531-46855553 CTGGTTTCCAAGATGGAGGAAGG + Intronic
1118457125 14:65954876-65954898 ACGCTTGGCCAGATGGGGGCAGG + Intergenic
1119233114 14:72996633-72996655 AGACTTGGCTAGATGGAGGAGGG - Intronic
1119529192 14:75347784-75347806 CTGCTTGGGCAGGAGGTGGATGG + Intergenic
1121416644 14:93783863-93783885 CTGATTGGCCAGGAGTAGGATGG - Intronic
1121416651 14:93783896-93783918 CTGATTGGCCAGGAGTAGGATGG - Intronic
1121416658 14:93783929-93783951 CTGATTGGCCAGGAGTAGGACGG - Intronic
1121990409 14:98551661-98551683 CTGGTGGGCAAGTTGGAGGAGGG + Intergenic
1122100108 14:99401802-99401824 CAACTTGGGCAGATTGAGGAAGG - Intronic
1122147452 14:99700130-99700152 CTGCCTGGCCAGAGGCAGTAGGG + Intronic
1122631236 14:103108712-103108734 CTGGTGGGGCTGATGGAGGATGG - Intronic
1124360426 15:29032922-29032944 CTGATTGGCCAGCTGCAGCATGG + Intronic
1124507879 15:30294553-30294575 CTGCTTTCCCTGATGGAAGAGGG + Intergenic
1124735676 15:32244104-32244126 CTGCTTTCCCTGATGGAAGAGGG - Intergenic
1127919995 15:63486648-63486670 TTGCTGGGCCAGAGGTAGGAAGG - Intergenic
1127964801 15:63915602-63915624 CTGCTGGGCCAGGAGGAGGGTGG - Intronic
1128524935 15:68406012-68406034 CTGCTGGGTCAGATGCAGGAAGG - Intronic
1128639212 15:69323461-69323483 CTCCTGGGCCAGAGGCAGGATGG + Intronic
1128765114 15:70246580-70246602 CTCCTTTGCCAGGTGCAGGATGG + Intergenic
1129883914 15:79025632-79025654 CTGCAGGGCCAGATGGCTGAGGG + Intronic
1129957733 15:79654822-79654844 ATGCATGGCCACAAGGAGGAGGG - Intergenic
1132554593 16:566950-566972 CAGCTGGGCCGGGTGGAGGAGGG - Intergenic
1132984618 16:2758255-2758277 CTGCTTGGAGAGGTGGAGGCAGG + Intronic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1134446127 16:14332877-14332899 CTGCTTGGGGAGATGGTGCAGGG + Intergenic
1135222623 16:20625740-20625762 CTGCCTGTACTGATGGAGGACGG + Intronic
1139550928 16:67672627-67672649 CTGCTTGGCCAGCAGGGTGATGG + Intergenic
1139695660 16:68672632-68672654 GTGCTTGGCCAGTGGGAGGAAGG - Intronic
1142367123 16:89656635-89656657 CTGCTTCCCCACATGGAGAATGG + Intronic
1142742715 17:1940523-1940545 CTCCTTGGGCAGATGGAGGCAGG - Intronic
1142899524 17:3003615-3003637 CTGCATGGCTGGAAGGAGGAAGG - Intronic
1144520156 17:15947732-15947754 CTGCTAGGCCAGCTGAGGGAAGG - Intronic
1145275085 17:21424359-21424381 CTGCTCGACCTGAGGGAGGATGG + Intergenic
1145312939 17:21710259-21710281 CTGCTCGACCTGAGGGAGGATGG + Intergenic
1146687651 17:34852383-34852405 CAGCTTGGGAAGGTGGAGGAGGG - Intergenic
1147167046 17:38599096-38599118 TTGCTTTGCCACATGGAGGGTGG - Intronic
1147894195 17:43739938-43739960 CTTCTTGGCCAGGTGGTGGGAGG - Intergenic
1148479300 17:47949666-47949688 CTGGGTGGCCAGATGGATGTGGG - Intergenic
1148638476 17:49167266-49167288 CTGCATGGCCAGGAGGAAGAGGG + Intronic
1148769592 17:50059203-50059225 CTTCTTGGCAAGATGCATGAGGG + Intronic
1151046291 17:70923428-70923450 CTGCTTGGCCATAAGAGGGATGG - Intergenic
1151827609 17:76531847-76531869 CGGCTTGGCCAGAGGGAGGAGGG - Intronic
1152337343 17:79706338-79706360 CTGCTTGGACGGAAGGTGGATGG - Intergenic
1152451259 17:80381924-80381946 CTGCTTGCCCAGAGGCTGGAAGG + Intronic
1152567428 17:81106550-81106572 CTTCATGGCCAGGAGGAGGAAGG + Intronic
1152618609 17:81349561-81349583 GGGCTTGGCCAGGTGGAGGTCGG + Intergenic
1153169633 18:2301166-2301188 CTGCCTTTCAAGATGGAGGAAGG + Intergenic
1155036220 18:22026968-22026990 CTGCCTGCCCAGGTGGGGGACGG - Intergenic
1155320509 18:24614184-24614206 CTGCAGGGCCAGCTGTAGGAGGG + Intergenic
1156362345 18:36394078-36394100 CTACTTGGGCAGATCAAGGAAGG + Intronic
1157280763 18:46345044-46345066 CAGCTTGGCCAGAAGGAGCGAGG - Intronic
1157377045 18:47176403-47176425 GTTCTTAGCCAGATGGAGGCGGG - Intergenic
1160067854 18:75594175-75594197 CTGGTTTACAAGATGGAGGAAGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160905980 19:1451935-1451957 GTGTGTGGCCAGGTGGAGGAGGG + Exonic
1161118540 19:2512698-2512720 CTGCCAGGGCAGAGGGAGGAGGG - Exonic
1161304031 19:3557195-3557217 CTGCTGGGCCAGGTGGCCGACGG - Exonic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1163123834 19:15233456-15233478 CTGTTGGGCCAGCAGGAGGACGG - Intergenic
1163650363 19:18514118-18514140 CTGCCAGGTCAGATGGAGGCGGG + Intronic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1163828535 19:19536961-19536983 AGGCTGGGTCAGATGGAGGAGGG + Intronic
1164575940 19:29405362-29405384 CTGCGAGGCGAGCTGGAGGAGGG - Intergenic
1164995527 19:32718406-32718428 CTGATTGGCCAGGTTGAAGATGG + Intergenic
1165420481 19:35719827-35719849 CTGCTAGGCGAGGAGGAGGAAGG - Exonic
1166388645 19:42396693-42396715 CTCCTGGGTCAGAGGGAGGAGGG - Intergenic
1166523938 19:43499327-43499349 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
1166532651 19:43552330-43552352 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1166532712 19:43552476-43552498 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1166546204 19:43636013-43636035 CTCCTGGGTCTGATGGAGGAGGG - Intronic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166679054 19:44756487-44756509 CTCCTGGGTCTGATGGAGGAGGG + Intronic
1167264896 19:48478604-48478626 CTCCTGGGCCTGATGGAGGAGGG + Intronic
1167264910 19:48478640-48478662 CTCCTGGGTCTGATGGAGGAGGG + Intronic
1167265042 19:48478969-48478991 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167288215 19:48610707-48610729 CTGCTGGGCCAGTTCCAGGAAGG + Exonic
1167328200 19:48837652-48837674 CTCCTGGGTCTGATGGAGGAGGG - Intronic
1167435511 19:49476354-49476376 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1167489248 19:49782238-49782260 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167495899 19:49818630-49818652 CTCCTGGGCCTGAGGGAGGAGGG + Intronic
1167664311 19:50814811-50814833 CTACTTGGCCAGAAGGACAAAGG + Intergenic
1167678850 19:50906834-50906856 CTCCTGGGCCTGAGGGAGGAGGG + Exonic
1167689143 19:50974956-50974978 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1167690102 19:50980034-50980056 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167690877 19:50983181-50983203 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1167738300 19:51310675-51310697 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1167792985 19:51692297-51692319 CTGCCTGGCCGGAGGGAGGAGGG + Intergenic
1168097669 19:54124730-54124752 CAGCTGGGCCAGATGGTGGGTGG - Intronic
1168107245 19:54172611-54172633 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1168157677 19:54485374-54485396 CAGCTTGTCCAGGTGGTGGACGG + Intergenic
1168238167 19:55076292-55076314 CTCCTGGGCCTGAGGGAGGAGGG + Intronic
1168238696 19:55078747-55078769 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
1168238767 19:55078932-55078954 CTCCTGGGTCTGATGGAGGAGGG + Intronic
1168263362 19:55208465-55208487 CTCCTGGGCCTGAAGGAGGAGGG + Intronic
1168263467 19:55208758-55208780 CTCCTGGGCCTGAAGGAGGAGGG + Intronic
1168306349 19:55438152-55438174 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1168325900 19:55538105-55538127 CTCCTGGGCCTGATGGAGGAGGG + Intergenic
1168325941 19:55538219-55538241 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
926206633 2:10838500-10838522 CTGATTGGGCAGCTGGAAGAGGG + Intergenic
926308549 2:11657894-11657916 TGGCTTGGCCAGAGGCAGGAGGG + Intergenic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
928327472 2:30330983-30331005 CTGCTAGGGGAGATGTAGGAAGG + Intergenic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
933858926 2:86444573-86444595 GTGCTTGGTGAGATGGAGGCAGG + Intronic
934853072 2:97713418-97713440 CTGCCTGCCCAGCTGCAGGATGG - Intergenic
936917869 2:117658685-117658707 CAGGTAGCCCAGATGGAGGAAGG + Intergenic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
938717080 2:134030500-134030522 CTGCCTGACCAGATGGATGTGGG + Intergenic
938902055 2:135806882-135806904 TTGCAGGGCCAGATGGAGCAGGG - Intronic
939692543 2:145283009-145283031 CTGAATGGGCAGTTGGAGGATGG + Intergenic
942858601 2:180582662-180582684 CTGATTAGCCTGCTGGAGGAAGG - Intergenic
943471980 2:188305529-188305551 CTGCTTGGGCAGGTAAAGGAAGG + Intronic
944616978 2:201471054-201471076 ATGCTTGGCCAACTGGAGTACGG - Intronic
947404858 2:229764593-229764615 CTGCTAAGCCAGAAGGAAGACGG + Intronic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
1168771391 20:419197-419219 CCACTTGGCCAGATGGAAGCTGG + Intronic
1172184973 20:33025876-33025898 CTCCTTGCCCAGAAGGAAGATGG + Intergenic
1172510411 20:35497020-35497042 CTGGTTGGCAAGATGTAGCAGGG + Intronic
1173686085 20:44924330-44924352 CTGCTGGGCGAGAGGGTGGAGGG - Intronic
1174048585 20:47751374-47751396 GTGGTTGGCCAGATGGAGTCAGG - Intronic
1174453269 20:50632496-50632518 CTTCTAGCCCGGATGGAGGAAGG + Intronic
1175212977 20:57373075-57373097 CTGCCTCCCCAGCTGGAGGAGGG - Intronic
1175423641 20:58851223-58851245 CTGCGTGGCCACATGGATGGTGG + Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175972798 20:62695469-62695491 CTGCCTTGCCAGGTGGACGAGGG - Intergenic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1180033515 21:45229050-45229072 CTGCTTGGCCAGAAGGCAGAAGG - Intergenic
1180228898 21:46414566-46414588 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228941 21:46414734-46414756 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1181848932 22:25735931-25735953 CTTCTTGGCCTGAAGGAAGAAGG - Intergenic
1182354198 22:29714945-29714967 CTGCTGGGAGAGAAGGAGGAGGG + Intergenic
1183727408 22:39597412-39597434 CAGCCTGGCCAGGTGCAGGAGGG + Intronic
1183989756 22:41589915-41589937 CTGATTGGCCAAATGAAGAAGGG + Intergenic
1184773613 22:46612386-46612408 GTCCTTGGCCTGTTGGAGGAAGG + Intronic
1185181842 22:49368232-49368254 CTGTTTGGGCACCTGGAGGATGG - Intergenic
1185227581 22:49661630-49661652 CTGCTGGGCGAGTGGGAGGAGGG - Intergenic
950787729 3:15450065-15450087 CAGCATTGCCAGATGGAGGGAGG - Intronic
951219640 3:20055610-20055632 CTGTGTGGCTAGATGGAGGTGGG + Intronic
952611538 3:35216059-35216081 CTGCTTGGCCCGCTGCAGGGCGG + Intergenic
953699564 3:45185341-45185363 ATACTTGGCCTGATGCAGGAAGG + Intergenic
953817964 3:46177287-46177309 CTGCCTTGCTAGATGGGGGAAGG + Intronic
954624250 3:52013916-52013938 CTGCCTGGCCAGACTTAGGAAGG - Intergenic
955375698 3:58394802-58394824 CTCCTTCTTCAGATGGAGGAAGG - Intronic
955839473 3:63096729-63096751 CTGCTTGGCCCGCTGCAGGGCGG + Intergenic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
958911610 3:100000457-100000479 CTGCTAGGCCAAATCAAGGAAGG + Intronic
961752693 3:129106576-129106598 CTGTCTGGCCAGATGGTGGCAGG - Intronic
962434820 3:135356790-135356812 CTCCTTGGGCAGAAGGAGGAAGG - Intergenic
963001739 3:140688027-140688049 CTGGTGGACCAGATCGAGGACGG + Exonic
963526371 3:146419734-146419756 CTGATTGTGAAGATGGAGGAAGG - Intronic
964726894 3:159822904-159822926 CTGTTTGGCAAGAGGGAGGTGGG + Intronic
965605785 3:170496504-170496526 CTGCTTGGCCCGCTGCAGGGCGG - Intronic
966277847 3:178197267-178197289 CTGTTTGGGGAGATGCAGGAGGG - Intergenic
967755906 3:193168213-193168235 CTGCTTGGCCAGGTGGTACAAGG + Intergenic
967972274 3:195008004-195008026 CTGCTCGGCAGGAAGGAGGACGG + Intergenic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
976148180 4:82064702-82064724 CTGGTTGCCCAGTTGGAGTAGGG - Intergenic
976656825 4:87497412-87497434 CTGCTTGGGCAGTAGGCGGATGG - Intronic
977807347 4:101316957-101316979 CTTCTTGGGAAGATAGAGGAAGG + Intronic
977928665 4:102729079-102729101 CTGCTTGGCCTGCTGCAGGGCGG + Intronic
978570392 4:110130670-110130692 ATCCTTGGCCGGATGGATGATGG - Intronic
979913703 4:126404294-126404316 CTGCCAAGCCAGCTGGAGGAGGG - Intergenic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
980814765 4:137930390-137930412 CTGCTTGTCCTGATAGGGGAAGG - Intergenic
981049812 4:140298647-140298669 CTGATTGGCCACAGGAAGGAAGG - Intronic
981667355 4:147245170-147245192 CTCATTGGCCAGATGTTGGAGGG - Intergenic
981789626 4:148521750-148521772 ATGCTTGGCTTGATGGAGGGAGG - Intergenic
982265966 4:153538615-153538637 CTGCTTGCCCTGAGGGAGGCGGG - Intronic
982650202 4:158078845-158078867 CTGCCTGGCCAGTTGGTTGATGG + Intergenic
985233689 4:187849706-187849728 CTGCCTGGCCTGATTAAGGAGGG - Intergenic
985798650 5:1985862-1985884 CTGCTGGGCTAGGTGGAGGCAGG - Intergenic
987383364 5:17306692-17306714 CTCCCTAGCCAGATGGGGGAAGG + Intergenic
988067315 5:26237665-26237687 CTGCTTGGCCACAGGAAGGAAGG - Intergenic
989100874 5:37822005-37822027 CTGCCTGGCCAGGCTGAGGAGGG - Intronic
990160282 5:52931141-52931163 GTGCTTGGTCAGTTGGTGGAGGG + Intronic
992324942 5:75651380-75651402 ATGCTGGGCCATTTGGAGGATGG + Intronic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
996432903 5:123401249-123401271 CTGCTTGGCCCGCTGCAGGGCGG + Intronic
996886407 5:128360185-128360207 TTCCTTGGACAGATGGAAGAAGG - Intronic
997361464 5:133297900-133297922 CTGCTGGTCCAGATGAGGGATGG - Intronic
998520826 5:142798908-142798930 CAGCTTGGCCTGGTGGATGAAGG - Intronic
1000207432 5:159075798-159075820 GAGCTTGGCAAGTTGGAGGAAGG - Intronic
1004384358 6:15159631-15159653 TTGCCTGGGTAGATGGAGGATGG - Intergenic
1004665029 6:17741606-17741628 CTGCCTGGCCCCATGGAGAAGGG + Intergenic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1007359570 6:41345465-41345487 CTTCTTGGCAAGAGTGAGGAGGG + Intronic
1007725829 6:43915071-43915093 CAGCCTGGGCACATGGAGGAGGG + Intergenic
1008491159 6:52088603-52088625 GTGCTTGGCCAGATTGGGGCAGG + Intergenic
1012545848 6:100418772-100418794 CTGCTTGGAAAGATGGATTATGG - Intronic
1017631225 6:156397757-156397779 CTGCTAGCCCAGAGGGAGGAAGG + Intergenic
1018956499 6:168413619-168413641 CTGCTTGTCCAGCAGGAGGGAGG + Intergenic
1019465697 7:1187317-1187339 CTGTTTAGCAAGAAGGAGGAAGG + Intergenic
1019609336 7:1929081-1929103 CTGCTCGGCCTCAGGGAGGAGGG - Intronic
1019989709 7:4682847-4682869 CTGCTTGGGCAGCTGCAGGGCGG - Exonic
1020606527 7:10344987-10345009 CTGTTTTGCCTGATGGTGGAAGG - Intergenic
1022464884 7:30646957-30646979 CTGAATGGCCAGAGGGAGTACGG + Intergenic
1023289661 7:38656266-38656288 CTGCTTGGCTAGCTGCAGGGCGG - Intergenic
1024248997 7:47492257-47492279 CTGTTTGGCCAGCAGCAGGAAGG + Intronic
1025836529 7:65099259-65099281 TTGGGTGGCCAAATGGAGGAAGG + Intergenic
1025906298 7:65788693-65788715 TTGGGTGGCCAAATGGAGGAAGG + Intergenic
1026966570 7:74443921-74443943 ATACTTGGCCAGAAGCAGGAGGG - Intergenic
1028910292 7:96200545-96200567 CTGCATGGCCAAATGGGGGGTGG - Intronic
1029032844 7:97487226-97487248 CTTCTTGGCAAGAAGAAGGATGG - Intergenic
1029172967 7:98643778-98643800 CTGCTGTGCCAGGTGGAGAAGGG + Intergenic
1029803570 7:102974855-102974877 CTGCTTGGGAAGATGGGGGCTGG - Intronic
1030568175 7:111187218-111187240 CTGCTTGGCCAGAAAGGGAAGGG - Intronic
1031603269 7:123739268-123739290 TTGCTTGGGCAGATAGTGGATGG - Intronic
1032200875 7:129821945-129821967 CTGCATGGCCAGAAGGCCGAGGG - Intergenic
1033276159 7:139973030-139973052 CTGCGTGGGGAGATGGAGGCAGG + Intronic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1034337141 7:150330885-150330907 CTGCTGGCCCAGAGGGAGAAGGG + Exonic
1034534567 7:151718952-151718974 CTACTTGGCAAGATGCAGGCTGG - Intronic
1034865277 7:154636385-154636407 CTGCTTGCCCAGGAGAAGGAAGG - Intronic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1037936307 8:22917237-22917259 CTTCTGGGCCTGATGGAGAAGGG - Intronic
1038176872 8:25188184-25188206 TTGTTTGGTTAGATGGAGGAAGG + Intronic
1039214803 8:35258146-35258168 CTGCATCGTCACATGGAGGAAGG + Intronic
1040928861 8:52714027-52714049 CCGCTGTGCCAGATGGGGGAAGG + Intronic
1042824429 8:72965716-72965738 CTGCGAGGCCAGAAGCAGGATGG + Intergenic
1043762537 8:84085713-84085735 CTCCTTGGCCTGAAGGAGCAAGG - Intergenic
1044339537 8:91030984-91031006 CTGCTTTGACAAATAGAGGATGG + Intronic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1046064573 8:109181282-109181304 CTCCTAGGCCTGAAGGAGGAAGG - Intergenic
1046740801 8:117827022-117827044 CTGATTTGCCAGATGAAAGATGG - Intronic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1048213880 8:132479236-132479258 ATGCATGGCCAGAAGGAAGAAGG - Intronic
1048496563 8:134940623-134940645 CTCCTTGGAGAGATGGAGAAAGG + Intergenic
1048971520 8:139647592-139647614 CATGCTGGCCAGATGGAGGAGGG + Intronic
1049218043 8:141416752-141416774 CTGCTTGCCCACCTGGAGGTGGG + Intronic
1051206911 9:14697620-14697642 CTCCTAGGCAAGAGGGAGGAAGG - Intergenic
1051593805 9:18803339-18803361 CTGGTTGTGAAGATGGAGGAAGG - Intronic
1052034962 9:23670063-23670085 CTCTTTGGCCAGATGGATCAGGG - Intergenic
1052989172 9:34508646-34508668 CTGCTTGGCTTGAGGAAGGAAGG - Intronic
1053130767 9:35614039-35614061 CTGTATGGCCAAATGGAAGAGGG + Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053654045 9:40197552-40197574 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1053819481 9:41952108-41952130 CTGATTGGCCAGACGGACTAGGG + Intronic
1053904433 9:42826729-42826751 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054109749 9:61095761-61095783 CTGATTGGCCAGACGGATTAGGG + Intergenic
1054366160 9:64343768-64343790 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054530552 9:66178785-66178807 GTGTTTGGGTAGATGGAGGAGGG - Intergenic
1054611108 9:67235364-67235386 CTGATTGGCCAGACGGATTAGGG - Intergenic
1054673789 9:67833498-67833520 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054780961 9:69165795-69165817 GTGCTTTGCAACATGGAGGAGGG - Intronic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1056849465 9:90070180-90070202 TTGCTTGGCCAGCTAGAGGCTGG + Intergenic
1057379594 9:94555783-94555805 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1057943660 9:99306232-99306254 CTGCTTGGCCCGCTGCAGGGCGG - Intergenic
1057995008 9:99813899-99813921 CTGGTTGCCCAGATTGAGGGAGG - Intergenic
1058633339 9:107011637-107011659 CTGCTGGGCAAGATGGTGAATGG + Exonic
1061418168 9:130459287-130459309 CAGCTTGGGAAGATGGAGGACGG - Intronic
1061543047 9:131288625-131288647 CTGCTCGCCCAGATGAAGGCAGG - Intergenic
1185697482 X:2206125-2206147 ATGCCTGTCCAGATGGAGGGTGG + Intergenic
1186371389 X:8951022-8951044 CTACTTCGCCAGAAGAAGGAAGG - Intergenic
1187260588 X:17682093-17682115 CTGCTTGGCAGTTTGGAGGAAGG - Intronic
1188551738 X:31372255-31372277 TTGGCTGACCAGATGGAGGAAGG + Intronic
1189295344 X:39913848-39913870 CTGCTTTGACTAATGGAGGATGG - Intergenic
1189893775 X:45632644-45632666 CTGCTTGGCCCGCTGCAGAACGG + Intergenic
1197651442 X:129069417-129069439 CTGCTTAACAAGATGGGGGAAGG + Intergenic
1198839213 X:140838713-140838735 CTAGTGGGCCAGATGGAGTATGG - Intergenic
1199655653 X:149992836-149992858 CTTCTTAGCCAGCTAGAGGAAGG + Intergenic
1199927276 X:152480645-152480667 CTGCTTGGCCCGCTGCAGGGTGG - Intergenic
1200830060 Y:7680512-7680534 CTTCTTGGCCAGGTAGGGGAAGG + Intergenic