ID: 927519433

View in Genome Browser
Species Human (GRCh38)
Location 2:23690092-23690114
Sequence GGGGAGGTGCAATCCTGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 194}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927519433_927519446 16 Left 927519433 2:23690092-23690114 CCGCAGCAGGATTGCACCTCCCC 0: 1
1: 0
2: 1
3: 17
4: 194
Right 927519446 2:23690131-23690153 GCCTGTGCTGAGGCCCTGGGAGG 0: 1
1: 0
2: 10
3: 67
4: 535
927519433_927519441 6 Left 927519433 2:23690092-23690114 CCGCAGCAGGATTGCACCTCCCC 0: 1
1: 0
2: 1
3: 17
4: 194
Right 927519441 2:23690121-23690143 TCCTGGCCATGCCTGTGCTGAGG 0: 1
1: 0
2: 3
3: 40
4: 313
927519433_927519444 12 Left 927519433 2:23690092-23690114 CCGCAGCAGGATTGCACCTCCCC 0: 1
1: 0
2: 1
3: 17
4: 194
Right 927519444 2:23690127-23690149 CCATGCCTGTGCTGAGGCCCTGG 0: 1
1: 0
2: 3
3: 31
4: 386
927519433_927519448 17 Left 927519433 2:23690092-23690114 CCGCAGCAGGATTGCACCTCCCC 0: 1
1: 0
2: 1
3: 17
4: 194
Right 927519448 2:23690132-23690154 CCTGTGCTGAGGCCCTGGGAGGG 0: 1
1: 0
2: 8
3: 81
4: 606
927519433_927519445 13 Left 927519433 2:23690092-23690114 CCGCAGCAGGATTGCACCTCCCC 0: 1
1: 0
2: 1
3: 17
4: 194
Right 927519445 2:23690128-23690150 CATGCCTGTGCTGAGGCCCTGGG 0: 1
1: 0
2: 1
3: 33
4: 342
927519433_927519449 20 Left 927519433 2:23690092-23690114 CCGCAGCAGGATTGCACCTCCCC 0: 1
1: 0
2: 1
3: 17
4: 194
Right 927519449 2:23690135-23690157 GTGCTGAGGCCCTGGGAGGGCGG 0: 1
1: 0
2: 9
3: 96
4: 739

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927519433 Original CRISPR GGGGAGGTGCAATCCTGCTG CGG (reversed) Intronic