ID: 927519435

View in Genome Browser
Species Human (GRCh38)
Location 2:23690108-23690130
Sequence ATGGCCAGGAGGAGAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1054
Summary {0: 1, 1: 0, 2: 11, 3: 107, 4: 935}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927519435_927519449 4 Left 927519435 2:23690108-23690130 CCTCCCCCTCTCCTCCTGGCCAT 0: 1
1: 0
2: 11
3: 107
4: 935
Right 927519449 2:23690135-23690157 GTGCTGAGGCCCTGGGAGGGCGG 0: 1
1: 0
2: 9
3: 96
4: 739
927519435_927519445 -3 Left 927519435 2:23690108-23690130 CCTCCCCCTCTCCTCCTGGCCAT 0: 1
1: 0
2: 11
3: 107
4: 935
Right 927519445 2:23690128-23690150 CATGCCTGTGCTGAGGCCCTGGG 0: 1
1: 0
2: 1
3: 33
4: 342
927519435_927519444 -4 Left 927519435 2:23690108-23690130 CCTCCCCCTCTCCTCCTGGCCAT 0: 1
1: 0
2: 11
3: 107
4: 935
Right 927519444 2:23690127-23690149 CCATGCCTGTGCTGAGGCCCTGG 0: 1
1: 0
2: 3
3: 31
4: 386
927519435_927519448 1 Left 927519435 2:23690108-23690130 CCTCCCCCTCTCCTCCTGGCCAT 0: 1
1: 0
2: 11
3: 107
4: 935
Right 927519448 2:23690132-23690154 CCTGTGCTGAGGCCCTGGGAGGG 0: 1
1: 0
2: 8
3: 81
4: 606
927519435_927519446 0 Left 927519435 2:23690108-23690130 CCTCCCCCTCTCCTCCTGGCCAT 0: 1
1: 0
2: 11
3: 107
4: 935
Right 927519446 2:23690131-23690153 GCCTGTGCTGAGGCCCTGGGAGG 0: 1
1: 0
2: 10
3: 67
4: 535
927519435_927519441 -10 Left 927519435 2:23690108-23690130 CCTCCCCCTCTCCTCCTGGCCAT 0: 1
1: 0
2: 11
3: 107
4: 935
Right 927519441 2:23690121-23690143 TCCTGGCCATGCCTGTGCTGAGG 0: 1
1: 0
2: 3
3: 40
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927519435 Original CRISPR ATGGCCAGGAGGAGAGGGGG AGG (reversed) Intronic