ID: 927519436

View in Genome Browser
Species Human (GRCh38)
Location 2:23690111-23690133
Sequence GGCATGGCCAGGAGGAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 816
Summary {0: 1, 1: 0, 2: 14, 3: 69, 4: 732}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927519436_927519448 -2 Left 927519436 2:23690111-23690133 CCCCCTCTCCTCCTGGCCATGCC 0: 1
1: 0
2: 14
3: 69
4: 732
Right 927519448 2:23690132-23690154 CCTGTGCTGAGGCCCTGGGAGGG 0: 1
1: 0
2: 8
3: 81
4: 606
927519436_927519445 -6 Left 927519436 2:23690111-23690133 CCCCCTCTCCTCCTGGCCATGCC 0: 1
1: 0
2: 14
3: 69
4: 732
Right 927519445 2:23690128-23690150 CATGCCTGTGCTGAGGCCCTGGG 0: 1
1: 0
2: 1
3: 33
4: 342
927519436_927519446 -3 Left 927519436 2:23690111-23690133 CCCCCTCTCCTCCTGGCCATGCC 0: 1
1: 0
2: 14
3: 69
4: 732
Right 927519446 2:23690131-23690153 GCCTGTGCTGAGGCCCTGGGAGG 0: 1
1: 0
2: 10
3: 67
4: 535
927519436_927519444 -7 Left 927519436 2:23690111-23690133 CCCCCTCTCCTCCTGGCCATGCC 0: 1
1: 0
2: 14
3: 69
4: 732
Right 927519444 2:23690127-23690149 CCATGCCTGTGCTGAGGCCCTGG 0: 1
1: 0
2: 3
3: 31
4: 386
927519436_927519449 1 Left 927519436 2:23690111-23690133 CCCCCTCTCCTCCTGGCCATGCC 0: 1
1: 0
2: 14
3: 69
4: 732
Right 927519449 2:23690135-23690157 GTGCTGAGGCCCTGGGAGGGCGG 0: 1
1: 0
2: 9
3: 96
4: 739

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927519436 Original CRISPR GGCATGGCCAGGAGGAGAGG GGG (reversed) Intronic