ID: 927519437

View in Genome Browser
Species Human (GRCh38)
Location 2:23690112-23690134
Sequence AGGCATGGCCAGGAGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 905
Summary {0: 1, 1: 1, 2: 7, 3: 83, 4: 813}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927519437_927519448 -3 Left 927519437 2:23690112-23690134 CCCCTCTCCTCCTGGCCATGCCT 0: 1
1: 1
2: 7
3: 83
4: 813
Right 927519448 2:23690132-23690154 CCTGTGCTGAGGCCCTGGGAGGG 0: 1
1: 0
2: 8
3: 81
4: 606
927519437_927519444 -8 Left 927519437 2:23690112-23690134 CCCCTCTCCTCCTGGCCATGCCT 0: 1
1: 1
2: 7
3: 83
4: 813
Right 927519444 2:23690127-23690149 CCATGCCTGTGCTGAGGCCCTGG 0: 1
1: 0
2: 3
3: 31
4: 386
927519437_927519449 0 Left 927519437 2:23690112-23690134 CCCCTCTCCTCCTGGCCATGCCT 0: 1
1: 1
2: 7
3: 83
4: 813
Right 927519449 2:23690135-23690157 GTGCTGAGGCCCTGGGAGGGCGG 0: 1
1: 0
2: 9
3: 96
4: 739
927519437_927519446 -4 Left 927519437 2:23690112-23690134 CCCCTCTCCTCCTGGCCATGCCT 0: 1
1: 1
2: 7
3: 83
4: 813
Right 927519446 2:23690131-23690153 GCCTGTGCTGAGGCCCTGGGAGG 0: 1
1: 0
2: 10
3: 67
4: 535
927519437_927519445 -7 Left 927519437 2:23690112-23690134 CCCCTCTCCTCCTGGCCATGCCT 0: 1
1: 1
2: 7
3: 83
4: 813
Right 927519445 2:23690128-23690150 CATGCCTGTGCTGAGGCCCTGGG 0: 1
1: 0
2: 1
3: 33
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927519437 Original CRISPR AGGCATGGCCAGGAGGAGAG GGG (reversed) Intronic