ID: 927519438

View in Genome Browser
Species Human (GRCh38)
Location 2:23690113-23690135
Sequence CAGGCATGGCCAGGAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 1, 2: 7, 3: 71, 4: 642}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927519438_927519446 -5 Left 927519438 2:23690113-23690135 CCCTCTCCTCCTGGCCATGCCTG 0: 1
1: 1
2: 7
3: 71
4: 642
Right 927519446 2:23690131-23690153 GCCTGTGCTGAGGCCCTGGGAGG 0: 1
1: 0
2: 10
3: 67
4: 535
927519438_927519449 -1 Left 927519438 2:23690113-23690135 CCCTCTCCTCCTGGCCATGCCTG 0: 1
1: 1
2: 7
3: 71
4: 642
Right 927519449 2:23690135-23690157 GTGCTGAGGCCCTGGGAGGGCGG 0: 1
1: 0
2: 9
3: 96
4: 739
927519438_927519454 30 Left 927519438 2:23690113-23690135 CCCTCTCCTCCTGGCCATGCCTG 0: 1
1: 1
2: 7
3: 71
4: 642
Right 927519454 2:23690166-23690188 CTCAGAGAATGTCGCTCTAATGG 0: 1
1: 0
2: 0
3: 4
4: 54
927519438_927519445 -8 Left 927519438 2:23690113-23690135 CCCTCTCCTCCTGGCCATGCCTG 0: 1
1: 1
2: 7
3: 71
4: 642
Right 927519445 2:23690128-23690150 CATGCCTGTGCTGAGGCCCTGGG 0: 1
1: 0
2: 1
3: 33
4: 342
927519438_927519448 -4 Left 927519438 2:23690113-23690135 CCCTCTCCTCCTGGCCATGCCTG 0: 1
1: 1
2: 7
3: 71
4: 642
Right 927519448 2:23690132-23690154 CCTGTGCTGAGGCCCTGGGAGGG 0: 1
1: 0
2: 8
3: 81
4: 606
927519438_927519444 -9 Left 927519438 2:23690113-23690135 CCCTCTCCTCCTGGCCATGCCTG 0: 1
1: 1
2: 7
3: 71
4: 642
Right 927519444 2:23690127-23690149 CCATGCCTGTGCTGAGGCCCTGG 0: 1
1: 0
2: 3
3: 31
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927519438 Original CRISPR CAGGCATGGCCAGGAGGAGA GGG (reversed) Intronic