ID: 927519441

View in Genome Browser
Species Human (GRCh38)
Location 2:23690121-23690143
Sequence TCCTGGCCATGCCTGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 313}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927519435_927519441 -10 Left 927519435 2:23690108-23690130 CCTCCCCCTCTCCTCCTGGCCAT 0: 1
1: 0
2: 11
3: 107
4: 935
Right 927519441 2:23690121-23690143 TCCTGGCCATGCCTGTGCTGAGG 0: 1
1: 0
2: 3
3: 40
4: 313
927519432_927519441 12 Left 927519432 2:23690086-23690108 CCAGCTCCGCAGCAGGATTGCAC 0: 1
1: 0
2: 1
3: 7
4: 79
Right 927519441 2:23690121-23690143 TCCTGGCCATGCCTGTGCTGAGG 0: 1
1: 0
2: 3
3: 40
4: 313
927519433_927519441 6 Left 927519433 2:23690092-23690114 CCGCAGCAGGATTGCACCTCCCC 0: 1
1: 0
2: 1
3: 17
4: 194
Right 927519441 2:23690121-23690143 TCCTGGCCATGCCTGTGCTGAGG 0: 1
1: 0
2: 3
3: 40
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927519441 Original CRISPR TCCTGGCCATGCCTGTGCTG AGG Intronic