ID: 927519444

View in Genome Browser
Species Human (GRCh38)
Location 2:23690127-23690149
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 386}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927519436_927519444 -7 Left 927519436 2:23690111-23690133 CCCCCTCTCCTCCTGGCCATGCC 0: 1
1: 0
2: 14
3: 69
4: 732
Right 927519444 2:23690127-23690149 CCATGCCTGTGCTGAGGCCCTGG 0: 1
1: 0
2: 3
3: 31
4: 386
927519437_927519444 -8 Left 927519437 2:23690112-23690134 CCCCTCTCCTCCTGGCCATGCCT 0: 1
1: 1
2: 7
3: 83
4: 813
Right 927519444 2:23690127-23690149 CCATGCCTGTGCTGAGGCCCTGG 0: 1
1: 0
2: 3
3: 31
4: 386
927519435_927519444 -4 Left 927519435 2:23690108-23690130 CCTCCCCCTCTCCTCCTGGCCAT 0: 1
1: 0
2: 11
3: 107
4: 935
Right 927519444 2:23690127-23690149 CCATGCCTGTGCTGAGGCCCTGG 0: 1
1: 0
2: 3
3: 31
4: 386
927519439_927519444 -10 Left 927519439 2:23690114-23690136 CCTCTCCTCCTGGCCATGCCTGT 0: 1
1: 1
2: 7
3: 83
4: 792
Right 927519444 2:23690127-23690149 CCATGCCTGTGCTGAGGCCCTGG 0: 1
1: 0
2: 3
3: 31
4: 386
927519438_927519444 -9 Left 927519438 2:23690113-23690135 CCCTCTCCTCCTGGCCATGCCTG 0: 1
1: 1
2: 7
3: 71
4: 642
Right 927519444 2:23690127-23690149 CCATGCCTGTGCTGAGGCCCTGG 0: 1
1: 0
2: 3
3: 31
4: 386
927519433_927519444 12 Left 927519433 2:23690092-23690114 CCGCAGCAGGATTGCACCTCCCC 0: 1
1: 0
2: 1
3: 17
4: 194
Right 927519444 2:23690127-23690149 CCATGCCTGTGCTGAGGCCCTGG 0: 1
1: 0
2: 3
3: 31
4: 386
927519432_927519444 18 Left 927519432 2:23690086-23690108 CCAGCTCCGCAGCAGGATTGCAC 0: 1
1: 0
2: 1
3: 7
4: 79
Right 927519444 2:23690127-23690149 CCATGCCTGTGCTGAGGCCCTGG 0: 1
1: 0
2: 3
3: 31
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type