ID: 927519446

View in Genome Browser
Species Human (GRCh38)
Location 2:23690131-23690153
Sequence GCCTGTGCTGAGGCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 0, 2: 10, 3: 67, 4: 535}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927519438_927519446 -5 Left 927519438 2:23690113-23690135 CCCTCTCCTCCTGGCCATGCCTG 0: 1
1: 1
2: 7
3: 71
4: 642
Right 927519446 2:23690131-23690153 GCCTGTGCTGAGGCCCTGGGAGG 0: 1
1: 0
2: 10
3: 67
4: 535
927519437_927519446 -4 Left 927519437 2:23690112-23690134 CCCCTCTCCTCCTGGCCATGCCT 0: 1
1: 1
2: 7
3: 83
4: 813
Right 927519446 2:23690131-23690153 GCCTGTGCTGAGGCCCTGGGAGG 0: 1
1: 0
2: 10
3: 67
4: 535
927519435_927519446 0 Left 927519435 2:23690108-23690130 CCTCCCCCTCTCCTCCTGGCCAT 0: 1
1: 0
2: 11
3: 107
4: 935
Right 927519446 2:23690131-23690153 GCCTGTGCTGAGGCCCTGGGAGG 0: 1
1: 0
2: 10
3: 67
4: 535
927519433_927519446 16 Left 927519433 2:23690092-23690114 CCGCAGCAGGATTGCACCTCCCC 0: 1
1: 0
2: 1
3: 17
4: 194
Right 927519446 2:23690131-23690153 GCCTGTGCTGAGGCCCTGGGAGG 0: 1
1: 0
2: 10
3: 67
4: 535
927519436_927519446 -3 Left 927519436 2:23690111-23690133 CCCCCTCTCCTCCTGGCCATGCC 0: 1
1: 0
2: 14
3: 69
4: 732
Right 927519446 2:23690131-23690153 GCCTGTGCTGAGGCCCTGGGAGG 0: 1
1: 0
2: 10
3: 67
4: 535
927519439_927519446 -6 Left 927519439 2:23690114-23690136 CCTCTCCTCCTGGCCATGCCTGT 0: 1
1: 1
2: 7
3: 83
4: 792
Right 927519446 2:23690131-23690153 GCCTGTGCTGAGGCCCTGGGAGG 0: 1
1: 0
2: 10
3: 67
4: 535
927519432_927519446 22 Left 927519432 2:23690086-23690108 CCAGCTCCGCAGCAGGATTGCAC 0: 1
1: 0
2: 1
3: 7
4: 79
Right 927519446 2:23690131-23690153 GCCTGTGCTGAGGCCCTGGGAGG 0: 1
1: 0
2: 10
3: 67
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927519446 Original CRISPR GCCTGTGCTGAGGCCCTGGG AGG Intronic