ID: 927519799

View in Genome Browser
Species Human (GRCh38)
Location 2:23691868-23691890
Sequence GCCCCCGGGCTCACCGAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 78}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927519799_927519809 12 Left 927519799 2:23691868-23691890 CCTTTCTCGGTGAGCCCGGGGGC 0: 1
1: 0
2: 2
3: 6
4: 78
Right 927519809 2:23691903-23691925 TTGGGGGGAAGAGTGCAGATGGG 0: 1
1: 0
2: 1
3: 25
4: 304
927519799_927519803 -6 Left 927519799 2:23691868-23691890 CCTTTCTCGGTGAGCCCGGGGGC 0: 1
1: 0
2: 2
3: 6
4: 78
Right 927519803 2:23691885-23691907 GGGGGCCACATATGTCGCTTGGG 0: 1
1: 0
2: 0
3: 1
4: 57
927519799_927519808 11 Left 927519799 2:23691868-23691890 CCTTTCTCGGTGAGCCCGGGGGC 0: 1
1: 0
2: 2
3: 6
4: 78
Right 927519808 2:23691902-23691924 CTTGGGGGGAAGAGTGCAGATGG 0: 1
1: 0
2: 7
3: 58
4: 504
927519799_927519810 15 Left 927519799 2:23691868-23691890 CCTTTCTCGGTGAGCCCGGGGGC 0: 1
1: 0
2: 2
3: 6
4: 78
Right 927519810 2:23691906-23691928 GGGGGAAGAGTGCAGATGGGCGG 0: 1
1: 0
2: 2
3: 51
4: 551
927519799_927519806 -3 Left 927519799 2:23691868-23691890 CCTTTCTCGGTGAGCCCGGGGGC 0: 1
1: 0
2: 2
3: 6
4: 78
Right 927519806 2:23691888-23691910 GGCCACATATGTCGCTTGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 52
927519799_927519802 -7 Left 927519799 2:23691868-23691890 CCTTTCTCGGTGAGCCCGGGGGC 0: 1
1: 0
2: 2
3: 6
4: 78
Right 927519802 2:23691884-23691906 CGGGGGCCACATATGTCGCTTGG 0: 1
1: 0
2: 0
3: 0
4: 36
927519799_927519805 -4 Left 927519799 2:23691868-23691890 CCTTTCTCGGTGAGCCCGGGGGC 0: 1
1: 0
2: 2
3: 6
4: 78
Right 927519805 2:23691887-23691909 GGGCCACATATGTCGCTTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 34
927519799_927519804 -5 Left 927519799 2:23691868-23691890 CCTTTCTCGGTGAGCCCGGGGGC 0: 1
1: 0
2: 2
3: 6
4: 78
Right 927519804 2:23691886-23691908 GGGGCCACATATGTCGCTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927519799 Original CRISPR GCCCCCGGGCTCACCGAGAA AGG (reversed) Exonic
900243360 1:1627066-1627088 GCCCCCAGGCTCACTGAGCGTGG + Exonic
901318523 1:8324718-8324740 GAGCCGGGGCTCACCGAGGATGG - Exonic
907579142 1:55556186-55556208 TCTCCCTGGCTCACTGAGAAAGG + Intergenic
916103047 1:161409234-161409256 GCCCCAGGTCTCACCTCGAAGGG - Intergenic
919807527 1:201389187-201389209 GCTCCCAGGCTCAGCCAGAATGG - Exonic
920345607 1:205303997-205304019 GCCCCCCTGCTCCCCAAGAAGGG - Exonic
924301260 1:242640438-242640460 GGCCCAGGGCTCACCGAAGATGG - Intergenic
1072771693 10:98145663-98145685 GCCACCGCGCCCAGCGAGAATGG - Intronic
1073009168 10:100346796-100346818 GCCCTCGGGCACACGGAGAACGG - Intergenic
1075089151 10:119433511-119433533 GCCCAGGTGATCACCGAGAAAGG - Intronic
1076465300 10:130676953-130676975 GCCCCAGGGCTCACTGGCAAGGG + Intergenic
1077331297 11:1984836-1984858 GCCCCCCGTCTCACCGAGAAGGG + Intergenic
1082809398 11:57469908-57469930 GCCTCCGGTCACACCGACAATGG - Intronic
1083391130 11:62351361-62351383 GCCACCAGGCTCAGCCAGAAAGG - Intronic
1084390034 11:68869358-68869380 GCCCCAGGTCTCACCTCGAAGGG + Intergenic
1085205803 11:74731301-74731323 GACCCCGAGCCCACCGAGCAGGG - Intronic
1088307759 11:108428113-108428135 GCCACCGCGCCCACCCAGAATGG + Intronic
1202814278 11_KI270721v1_random:40012-40034 GCCCCCCGTCTCACCGAGAAGGG + Intergenic
1104568506 12:129904697-129904719 TCCCCAGGGCTCACTGGGAAAGG + Intergenic
1105851589 13:24340434-24340456 GACCCCAGGCCCAGCGAGAACGG - Intergenic
1111120895 13:83847497-83847519 GCTCCCGGGCTCACACAGAGAGG + Intergenic
1111937282 13:94570217-94570239 GCCCCCTGCCTCACCCAGGATGG - Intergenic
1112202764 13:97292680-97292702 GACCTGGGGCTCACCGAGAGAGG - Intronic
1113803201 13:113096922-113096944 GCCCCCGGACGCCCCGAGGAAGG + Exonic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1118718371 14:68576262-68576284 GCCCCAGGGGTCACAGAGCAGGG + Intronic
1138603362 16:58071120-58071142 GCCACCGGGCCCAGCCAGAAAGG + Intergenic
1142030589 16:87836484-87836506 GGCCCCGGGCTCACCTTGATGGG + Exonic
1142813485 17:2407656-2407678 GCCCCAGGGCCCACTGGGAAAGG + Intronic
1144727302 17:17508259-17508281 GCCCCCAGGCTCACCGGCCATGG - Intronic
1147175786 17:38655334-38655356 GCCACCACGCTCACCCAGAAAGG - Intergenic
1148721391 17:49755804-49755826 TCCCCCAGGCTCACTCAGAATGG - Intronic
1149712474 17:58755965-58755987 GCCCCAGGGCAGACCGGGAAAGG - Exonic
1152357705 17:79814819-79814841 GCCGCCGGGCTCCCCGAGGTTGG - Intergenic
1152721466 17:81925926-81925948 GCCCCGGGGCTCACTGAGAGTGG + Intronic
1152876815 17:82790982-82791004 GCCCACGGGCTCAGCGGCAAAGG - Intronic
1152892622 17:82891064-82891086 GCCCCAGGGCCCACCCAGCACGG - Intronic
1158596131 18:58817444-58817466 GCCACCGTGCTCAGCAAGAAAGG - Intergenic
1161719019 19:5893021-5893043 GGCCTCGGGCTCCCTGAGAAAGG - Exonic
1164498718 19:28793720-28793742 GACCCCGGGCTCTCGGAGCAAGG - Intergenic
925829412 2:7879369-7879391 TCCCCCGGGATCACCGAGTAAGG - Intergenic
927519799 2:23691868-23691890 GCCCCCGGGCTCACCGAGAAAGG - Exonic
929410497 2:41693655-41693677 GCCCCCAGGGTCACAGATAAAGG + Intergenic
931756993 2:65383311-65383333 GGCCCCGGCCTCACAGACAAGGG - Intronic
932430538 2:71671466-71671488 CCCCCAGGGCTCACCTACAAGGG + Intronic
946412853 2:219523610-219523632 GCCACCTGGCTCACCCAGGAGGG - Intronic
948029933 2:234809275-234809297 GGCCCCAGGCTCACCCATAATGG + Intergenic
948362974 2:237435707-237435729 GTCCCCTGGCTCACCAACAAGGG + Intergenic
948368881 2:237475185-237475207 GGCCCCGGGGTCCCCGGGAAGGG + Intergenic
1173827725 20:46058077-46058099 GCCCCACGGCTCGGCGAGAAGGG - Intronic
1175149448 20:56921585-56921607 ACCCCTGGGCTGACGGAGAAGGG - Intergenic
1177431620 21:20997888-20997910 GCGCCCCGGCTCAACGTGAATGG - Intergenic
1180070923 21:45435496-45435518 GCCCCCAGGGTCACTAAGAACGG - Intronic
1180104992 21:45612704-45612726 ACCCCTGGGCTCTCCCAGAAGGG + Intergenic
1181528789 22:23504317-23504339 GGTCCCGGGCTCACCGGGATGGG - Intergenic
1181573573 22:23780644-23780666 TCCCCAAGACTCACCGAGAAGGG + Exonic
1185027358 22:48423110-48423132 GCCCCAGGGCTGACTGTGAAGGG + Intergenic
950729798 3:14947682-14947704 GCCGCCGGGGTCGCGGAGAAGGG - Intronic
952153595 3:30619444-30619466 GCCCCCATGCTCAAAGAGAAAGG - Intronic
962263104 3:133927500-133927522 GCCGCCGGGCCCTCCGAGTAGGG + Intergenic
963158704 3:142127912-142127934 GCCACTGGGCTCAGCCAGAAGGG - Intronic
969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG + Intronic
969646900 4:8435909-8435931 GCCCCAGGTCTCACCTTGAAGGG + Intronic
982819448 4:159927859-159927881 GAGCCCGGGCTCTCCTAGAAAGG - Intergenic
985939269 5:3121501-3121523 GCCCCTGAGCTCACCGAAAATGG - Intergenic
993320237 5:86461653-86461675 GCCCCAGGTCTCACCTCGAAGGG + Intergenic
993795026 5:92256335-92256357 CCTCCCGGGTTCACGGAGAAAGG + Intergenic
1002188440 5:177466858-177466880 GCCCCCGGGCGCACCCTGACGGG - Intronic
1002309179 5:178304220-178304242 GCCACCGCGCCCACAGAGAAAGG - Intronic
1006411009 6:33873167-33873189 GCTCCCGGGGTCACTGAGGAGGG - Intergenic
1007040233 6:38715192-38715214 GCCCCCGCGCTCCCCAATAAAGG - Intergenic
1008582863 6:52922224-52922246 GCCCCAGGTCTCACCTCGAAGGG + Intergenic
1017940597 6:159049402-159049424 GGCCCCGGGCTCACAGATACAGG + Intergenic
1019305636 7:333074-333096 ACCCCCGCGCTCACCGAGAGAGG + Intergenic
1028255298 7:88588579-88588601 GCTCCTGAGATCACCGAGAAAGG - Intergenic
1035948996 8:3997989-3998011 GTCCCCGGGCTCAGCCAGAATGG + Exonic
1037898466 8:22673832-22673854 GCTCCAGGGCACACCCAGAAGGG + Intergenic
1038612514 8:29069294-29069316 GCCCCCAGGCCCACCGTGCATGG - Exonic
1040291209 8:46125979-46126001 GCCCCAGGTCTCACCTTGAAGGG + Intergenic
1040329969 8:46380919-46380941 CCCCCCGGGCTGACCCAGGAAGG + Intergenic
1048345422 8:133571647-133571669 GCCCCCGCGCACCCCGAGCAGGG + Intronic
1049657710 8:143806060-143806082 GCTCCTGGGCTGACCGAGAGGGG - Intronic
1055611008 9:78024269-78024291 GCCACCGGGCGCACAGTGAAAGG - Intronic
1060876474 9:127087535-127087557 GCCCACGTGCCCACCGGGAAGGG + Exonic
1061749992 9:132770708-132770730 GCCCCAGGGCTCCCCTTGAAGGG - Intronic
1061856034 9:133442510-133442532 GCCCCACAGCTCACCGAGCAGGG - Exonic
1188542636 X:31266887-31266909 GCCGCCGGGCTCCCCGAAAGTGG + Intronic