ID: 927523618

View in Genome Browser
Species Human (GRCh38)
Location 2:23718321-23718343
Sequence TAGCCTCCTCACAGCAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927523610_927523618 12 Left 927523610 2:23718286-23718308 CCAGACCCAGACCCAGGTGAGCC No data
Right 927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG No data
927523613_927523618 6 Left 927523613 2:23718292-23718314 CCAGACCCAGGTGAGCCCTAGGA No data
Right 927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG No data
927523617_927523618 -10 Left 927523617 2:23718308-23718330 CCTAGGAAAGCATTAGCCTCCTC No data
Right 927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG No data
927523611_927523618 7 Left 927523611 2:23718291-23718313 CCCAGACCCAGGTGAGCCCTAGG No data
Right 927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG No data
927523614_927523618 1 Left 927523614 2:23718297-23718319 CCCAGGTGAGCCCTAGGAAAGCA No data
Right 927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG No data
927523615_927523618 0 Left 927523615 2:23718298-23718320 CCAGGTGAGCCCTAGGAAAGCAT No data
Right 927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG No data
927523616_927523618 -9 Left 927523616 2:23718307-23718329 CCCTAGGAAAGCATTAGCCTCCT No data
Right 927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG No data
927523608_927523618 30 Left 927523608 2:23718268-23718290 CCTCTCTCATTACACTCTCCAGA No data
Right 927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927523618 Original CRISPR TAGCCTCCTCACAGCAACAG TGG Intergenic
No off target data available for this crispr