ID: 927523808

View in Genome Browser
Species Human (GRCh38)
Location 2:23719756-23719778
Sequence GCTTTCTGTGGGTTAAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927523808_927523812 -4 Left 927523808 2:23719756-23719778 CCTTATCTTAACCCACAGAAAGC No data
Right 927523812 2:23719775-23719797 AAGCATCACAAGTACCTAAAGGG No data
927523808_927523815 17 Left 927523808 2:23719756-23719778 CCTTATCTTAACCCACAGAAAGC No data
Right 927523815 2:23719796-23719818 GGAGAAATATCCCTGAGGACTGG No data
927523808_927523811 -5 Left 927523808 2:23719756-23719778 CCTTATCTTAACCCACAGAAAGC No data
Right 927523811 2:23719774-23719796 AAAGCATCACAAGTACCTAAAGG No data
927523808_927523814 12 Left 927523808 2:23719756-23719778 CCTTATCTTAACCCACAGAAAGC No data
Right 927523814 2:23719791-23719813 TAAAGGGAGAAATATCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927523808 Original CRISPR GCTTTCTGTGGGTTAAGATA AGG (reversed) Intergenic
No off target data available for this crispr