ID: 927523811

View in Genome Browser
Species Human (GRCh38)
Location 2:23719774-23719796
Sequence AAAGCATCACAAGTACCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927523808_927523811 -5 Left 927523808 2:23719756-23719778 CCTTATCTTAACCCACAGAAAGC No data
Right 927523811 2:23719774-23719796 AAAGCATCACAAGTACCTAAAGG No data
927523807_927523811 0 Left 927523807 2:23719751-23719773 CCTGTCCTTATCTTAACCCACAG No data
Right 927523811 2:23719774-23719796 AAAGCATCACAAGTACCTAAAGG No data
927523806_927523811 12 Left 927523806 2:23719739-23719761 CCTGGCAGGAGTCCTGTCCTTAT No data
Right 927523811 2:23719774-23719796 AAAGCATCACAAGTACCTAAAGG No data
927523805_927523811 24 Left 927523805 2:23719727-23719749 CCATCTTACGTTCCTGGCAGGAG No data
Right 927523811 2:23719774-23719796 AAAGCATCACAAGTACCTAAAGG No data
927523801_927523811 29 Left 927523801 2:23719722-23719744 CCCCACCATCTTACGTTCCTGGC No data
Right 927523811 2:23719774-23719796 AAAGCATCACAAGTACCTAAAGG No data
927523802_927523811 28 Left 927523802 2:23719723-23719745 CCCACCATCTTACGTTCCTGGCA No data
Right 927523811 2:23719774-23719796 AAAGCATCACAAGTACCTAAAGG No data
927523803_927523811 27 Left 927523803 2:23719724-23719746 CCACCATCTTACGTTCCTGGCAG No data
Right 927523811 2:23719774-23719796 AAAGCATCACAAGTACCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927523811 Original CRISPR AAAGCATCACAAGTACCTAA AGG Intergenic
No off target data available for this crispr