ID: 927523814

View in Genome Browser
Species Human (GRCh38)
Location 2:23719791-23719813
Sequence TAAAGGGAGAAATATCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927523810_927523814 0 Left 927523810 2:23719768-23719790 CCACAGAAAGCATCACAAGTACC No data
Right 927523814 2:23719791-23719813 TAAAGGGAGAAATATCCCTGAGG No data
927523809_927523814 1 Left 927523809 2:23719767-23719789 CCCACAGAAAGCATCACAAGTAC No data
Right 927523814 2:23719791-23719813 TAAAGGGAGAAATATCCCTGAGG No data
927523808_927523814 12 Left 927523808 2:23719756-23719778 CCTTATCTTAACCCACAGAAAGC No data
Right 927523814 2:23719791-23719813 TAAAGGGAGAAATATCCCTGAGG No data
927523806_927523814 29 Left 927523806 2:23719739-23719761 CCTGGCAGGAGTCCTGTCCTTAT No data
Right 927523814 2:23719791-23719813 TAAAGGGAGAAATATCCCTGAGG No data
927523807_927523814 17 Left 927523807 2:23719751-23719773 CCTGTCCTTATCTTAACCCACAG No data
Right 927523814 2:23719791-23719813 TAAAGGGAGAAATATCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927523814 Original CRISPR TAAAGGGAGAAATATCCCTG AGG Intergenic
No off target data available for this crispr