ID: 927523830

View in Genome Browser
Species Human (GRCh38)
Location 2:23719904-23719926
Sequence GTTAAGCAGCGCCATGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927523828_927523830 4 Left 927523828 2:23719877-23719899 CCAAATGAGACACCAAAGCAAAT No data
Right 927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG No data
927523829_927523830 -8 Left 927523829 2:23719889-23719911 CCAAAGCAAATGTCTGTTAAGCA No data
Right 927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG No data
927523826_927523830 29 Left 927523826 2:23719852-23719874 CCCTGGAAACTGCTCTGTAACTC No data
Right 927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG No data
927523827_927523830 28 Left 927523827 2:23719853-23719875 CCTGGAAACTGCTCTGTAACTCT No data
Right 927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927523830 Original CRISPR GTTAAGCAGCGCCATGCTGT AGG Intergenic
No off target data available for this crispr