ID: 927526314

View in Genome Browser
Species Human (GRCh38)
Location 2:23744573-23744595
Sequence TGCAGTAACCACCATGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927526310_927526314 28 Left 927526310 2:23744522-23744544 CCTGGTACTGTTCTAAGTGCTTT 0: 12
1: 106
2: 502
3: 1617
4: 4183
Right 927526314 2:23744573-23744595 TGCAGTAACCACCATGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927526314 Original CRISPR TGCAGTAACCACCATGGGGT TGG Intergenic
No off target data available for this crispr