ID: 927526962

View in Genome Browser
Species Human (GRCh38)
Location 2:23752892-23752914
Sequence CTAGAGGCCTAGTTTAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927526962_927526968 11 Left 927526962 2:23752892-23752914 CCCTCCCTAAACTAGGCCTCTAG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 927526968 2:23752926-23752948 TCCACACTGAGATGTTTCACTGG 0: 1
1: 0
2: 0
3: 12
4: 141
927526962_927526970 16 Left 927526962 2:23752892-23752914 CCCTCCCTAAACTAGGCCTCTAG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 927526970 2:23752931-23752953 ACTGAGATGTTTCACTGGTGAGG 0: 1
1: 0
2: 4
3: 7
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927526962 Original CRISPR CTAGAGGCCTAGTTTAGGGA GGG (reversed) Intronic
906809207 1:48809110-48809132 CAATAGCCCTACTTTAGGGAAGG + Intronic
911151892 1:94604157-94604179 CCAGGGGGCTAGTATAGGGACGG + Intergenic
912467515 1:109884045-109884067 CTAGAGGCCTAGAATGGGGTGGG + Intergenic
913273876 1:117119678-117119700 CTAGAGGGCTACTATAGGAAAGG - Intronic
916675119 1:167059087-167059109 CTCTAGGCCTTGTTTAGGGTGGG + Intronic
916948343 1:169753745-169753767 CTAGAGGCCCAGTGTAGAGGTGG + Intronic
917771125 1:178279411-178279433 GTAATGGCCTGGTTTAGGGATGG - Intronic
920092382 1:203463921-203463943 CTAGCGGCTGAGCTTAGGGAGGG - Intergenic
922614282 1:226952081-226952103 CCAGAGGCCAACATTAGGGAAGG + Intronic
1062853754 10:768365-768387 CTGGAAGCCTAGCTTGGGGATGG + Intergenic
1063769997 10:9185440-9185462 CAACAGGCTTAGTTTAGGGCAGG + Intergenic
1064653646 10:17535255-17535277 CTGCATGCCTAGGTTAGGGAGGG - Intergenic
1067174160 10:43930780-43930802 TTAGAGGCCGAGGTTAGGGAAGG + Intergenic
1068243710 10:54337643-54337665 CTAAAGGGCCAGTGTAGGGATGG - Intronic
1069604378 10:69730484-69730506 CGGGAGGCCTGCTTTAGGGAAGG + Intergenic
1070492282 10:76988701-76988723 CTCCAGACCTATTTTAGGGATGG + Intronic
1070503557 10:77093659-77093681 CTAGGGCCATAGTTTGGGGAAGG + Intronic
1073131931 10:101195256-101195278 ATAGAGGCCTAGGATGGGGAAGG - Intergenic
1080718319 11:34825206-34825228 CTAGACTCCTAGTGTAAGGAAGG + Intergenic
1087022629 11:93618512-93618534 CTGAAGGGCTAGTATAGGGATGG - Intergenic
1088142328 11:106632619-106632641 CTAGAGGCCTAGTTCATTGAGGG - Intergenic
1090342168 11:126033675-126033697 CTAAAGGCTTTGATTAGGGACGG + Intronic
1093006158 12:14053557-14053579 CTTGAGGCCTAGGCTTGGGAGGG - Intergenic
1096496760 12:52043282-52043304 GTAGGGGCCGAGTTGAGGGAGGG - Intronic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1108481542 13:50877615-50877637 GTAGAGACCTTGTGTAGGGAGGG + Intergenic
1112740527 13:102467880-102467902 CTAGAGGTCCAGTTGAGGAAGGG + Intergenic
1115992969 14:39168709-39168731 CTGTAGGCCTTGTTTAAGGATGG - Intronic
1121921589 14:97887210-97887232 CTAGGGGCCTGATTTATGGAGGG + Intergenic
1122776470 14:104119119-104119141 CCAGAGGCAGAGTTGAGGGAGGG - Intergenic
1126336625 15:47592083-47592105 CTGGAGACCTAGATTAGGGCTGG - Intronic
1126484741 15:49167809-49167831 CAAGATGCCTAGTATAAGGAAGG + Intronic
1129246280 15:74280810-74280832 CTAGGGGCCCAGTTCAGGGCAGG - Intronic
1132404472 15:101533830-101533852 GAAGAGGCCCAGTGTAGGGAAGG - Intergenic
1135788403 16:25371371-25371393 CTCGAGGGCTAGTTTTGGGAAGG + Intergenic
1143137688 17:4720855-4720877 CCAGAGGCCTAGCTTCGGGGAGG + Intronic
1145688693 17:26708080-26708102 TTTGAGGCCTATTTTAGAGAAGG + Intergenic
1146778289 17:35642212-35642234 CTAGACTCTTAGTTTAGTGAAGG + Intronic
1148534035 17:48423314-48423336 TTAGAGGCTTAGTTGAGGGGAGG + Intronic
1152031764 17:77847275-77847297 CCAGAGGCAGAGTTTTGGGACGG - Intergenic
1159129137 18:64260054-64260076 CTTGAGACCTAGGTTAGGCAAGG - Intergenic
1160017725 18:75157308-75157330 ATGGAGCCCTGGTTTAGGGACGG + Intergenic
1160748471 19:722615-722637 CTAGAGGCCTGGGCTAGGGTGGG + Intronic
1163365487 19:16873652-16873674 CTAGAGGAGTTGTTTATGGAAGG - Intronic
1163720961 19:18898138-18898160 CTAGGGGCCTAGTGTAGGGGTGG + Intergenic
925249961 2:2423883-2423905 CTACAGGAGGAGTTTAGGGAAGG + Intergenic
926451856 2:13013547-13013569 TTAGAGCCCTAGCTCAGGGAGGG - Intergenic
927308824 2:21605041-21605063 CTAGAGTCTTACTTTACGGATGG + Intergenic
927526962 2:23752892-23752914 CTAGAGGCCTAGTTTAGGGAGGG - Intronic
937339612 2:121082687-121082709 CTGGAGGCCTAGGGTAGGGTAGG + Intergenic
942449636 2:176100802-176100824 ACAGAGGCCTTGTTTGGGGAGGG + Exonic
946309348 2:218874087-218874109 CTAGAGGCCAAGGGGAGGGAGGG - Exonic
947570085 2:231226953-231226975 CTTGAGGCCCATTTTCGGGAGGG + Intronic
1168801745 20:647795-647817 CTAGCTGCCAAGTTTGGGGATGG + Exonic
1170588543 20:17753676-17753698 CCAAAGGCCTAGGGTAGGGAGGG - Intergenic
1170851539 20:20009251-20009273 CTGGAGACGTAGTTTAGGGGAGG - Intergenic
1171735861 20:28782995-28783017 TTTGAGGTCTAGTTTAGGAAAGG - Intergenic
1174576330 20:51540383-51540405 CTAGAGCCCTAGTCTAATGAAGG + Intronic
1175529748 20:59666327-59666349 CCAGTGGCCTGGTTTAGGCAGGG - Intronic
1176113036 20:63419110-63419132 CAACAGGCCTGGTTTAGGGCAGG - Intronic
1177831166 21:26140584-26140606 CCAGAGGCCTGATTTAGAGAAGG - Intronic
1181473224 22:23153431-23153453 CAGGAGGCCTAGGTCAGGGAGGG - Intronic
953019330 3:39103875-39103897 CTAGAGGGCTAGGCTAGGGTTGG + Intronic
953747115 3:45583560-45583582 CTGGAGGGCTACTTCAGGGAGGG - Intronic
954455072 3:50593307-50593329 GCAGAGGGCTAGTTTAGGGAAGG + Intergenic
955719567 3:61866959-61866981 CTAGAGCCTGAGTTCAGGGAAGG + Intronic
956273478 3:67472700-67472722 CCAGAGGACTATTTTAGGGAAGG + Intronic
959167230 3:102795546-102795568 CAAGGGGACTGGTTTAGGGAAGG + Intergenic
959973879 3:112436939-112436961 CTAGAGGCCCAGGGTAGGGTGGG - Intergenic
964397903 3:156266568-156266590 CTAGAGGCCAACTATAGAGAGGG + Intronic
964631511 3:158815442-158815464 CTATATGCCTATTTTAGGAAGGG - Intronic
972584983 4:40429571-40429593 CTAGAGGCACTTTTTAGGGATGG - Intronic
975498498 4:75059091-75059113 CAATACGCCTAGTTTAGGGCTGG - Intergenic
986643969 5:9898437-9898459 GAATAGGCCTAGCTTAGGGAAGG - Intergenic
988664870 5:33315432-33315454 CTAGAGGCCTGGTTTAGTCCAGG - Intergenic
989638432 5:43559913-43559935 TCAGAGGGCTAGTTTAGGGAAGG - Intergenic
989665804 5:43852557-43852579 CTAGAGACCTAGTTCAGGGGAGG - Intergenic
991631073 5:68656816-68656838 CTGGAGGCCTTGATAAGGGATGG + Intergenic
994049766 5:95349198-95349220 CTTCAGCCCCAGTTTAGGGATGG + Intergenic
994713920 5:103299228-103299250 TTAGAGGACTATTTCAGGGAGGG - Intergenic
1001060310 5:168482762-168482784 GTGGAGTCCTAATTTAGGGAGGG - Intergenic
1003191519 6:3879312-3879334 CTAGAGGGGTTGGTTAGGGAGGG + Intergenic
1003868829 6:10385794-10385816 CCAGAGGCCTAGAGAAGGGAGGG + Intergenic
1004428947 6:15526208-15526230 CTAGAGGCATAGTGAAGGAAGGG + Intronic
1008113428 6:47518942-47518964 CAAGAGGCGGAGTGTAGGGAGGG - Intronic
1008831909 6:55774796-55774818 CTGGAAGCCTAGTCTGGGGATGG + Intronic
1009468824 6:64006670-64006692 CTAAATGCCTAGTTTATTGAGGG + Intronic
1014199119 6:118589239-118589261 CTAGAGACCTAGTTTAGTCATGG - Intronic
1015831914 6:137379133-137379155 GTAGAGGTCTAGATTAGGCAGGG + Intergenic
1019233345 6:170586849-170586871 GTCAAGGCCTAGTTGAGGGAAGG - Intergenic
1020430558 7:8112814-8112836 CTAGAGGCCCAGAGTAGGGGTGG - Intergenic
1021122741 7:16815315-16815337 AGAGAGGCCTGGTTTAGGGTGGG + Intronic
1032004321 7:128287743-128287765 CAAGAGGCCTGATTTAGGGAAGG + Intergenic
1032279176 7:130486962-130486984 CTGGGGGCCTGGTTCAGGGAGGG + Intronic
1034218091 7:149422986-149423008 CCAGAGGCCTGGCTTGGGGAAGG + Intergenic
1043857834 8:85281743-85281765 CAGGAGGCCTACTTTAGGGCAGG - Exonic
1044405154 8:91818360-91818382 CAAGAGACTCAGTTTAGGGAAGG + Intergenic
1045234584 8:100339720-100339742 CTAGTTGCCTACTTTAGTGATGG - Intronic
1045611289 8:103845999-103846021 CAAAAGGCCTAGTTTAAGAATGG - Intronic
1047161403 8:122384343-122384365 CTGTAGGCCAAGTTAAGGGACGG + Intergenic
1050271448 9:3950186-3950208 ATAGTGGCTTAGCTTAGGGAAGG - Intronic
1051418704 9:16870428-16870450 CTTGGGGCCAAGTTTAGGGGAGG + Intronic
1057577335 9:96253724-96253746 CTTGAGGCATAGTTTGGGGGTGG + Intronic
1058443711 9:105034637-105034659 ATAGAGGCCCAGAGTAGGGAAGG + Intergenic
1061662351 9:132138636-132138658 GTAGAGGCCTTGCTTGGGGATGG - Intergenic
1061779420 9:132987026-132987048 CTGGAGGCCCAGTCTAGGGCTGG + Intronic
1062340911 9:136093717-136093739 CAAGAGGCCTCTTTAAGGGAGGG + Intronic
1193188006 X:78536374-78536396 CTAGAGGCTGAGGTCAGGGAAGG - Intergenic
1194030948 X:88813548-88813570 CTAAATGCCTAGTTTATTGAGGG - Intergenic
1194363400 X:92983407-92983429 ATTGAGGCCAAGTTTAGGAAAGG + Intergenic
1194988146 X:100513488-100513510 CTAGAGGCCTAAGGTAGAGAGGG + Intergenic
1197047102 X:122010542-122010564 CTAGAGGGCTATTGCAGGGAAGG + Intergenic
1197880939 X:131165687-131165709 CCAGAGGACTATTTTTGGGAAGG + Intergenic
1200671636 Y:6099652-6099674 ATTGAGGCCAAGTTTAGGAAAGG + Intergenic