ID: 927530369

View in Genome Browser
Species Human (GRCh38)
Location 2:23792389-23792411
Sequence TTGTTAGTCCCCAGTTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927530366_927530369 21 Left 927530366 2:23792345-23792367 CCAACCTTTTTGTTTTATCGAAT 0: 1
1: 0
2: 0
3: 19
4: 342
Right 927530369 2:23792389-23792411 TTGTTAGTCCCCAGTTTTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 167
927530367_927530369 17 Left 927530367 2:23792349-23792371 CCTTTTTGTTTTATCGAATTTAT 0: 1
1: 0
2: 4
3: 88
4: 1026
Right 927530369 2:23792389-23792411 TTGTTAGTCCCCAGTTTTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 167
927530365_927530369 26 Left 927530365 2:23792340-23792362 CCTGGCCAACCTTTTTGTTTTAT 0: 1
1: 1
2: 18
3: 302
4: 4456
Right 927530369 2:23792389-23792411 TTGTTAGTCCCCAGTTTTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927530369 Original CRISPR TTGTTAGTCCCCAGTTTTGA AGG Intronic
902092074 1:13911470-13911492 TTGTGATTCCCCAGTGCTGAAGG - Intergenic
904727218 1:32558594-32558616 TTGTTAGTCTCCAAGTCTGAAGG + Intronic
905581582 1:39086489-39086511 TTACTTGTCCCCAGTCTTGAAGG + Intronic
906198362 1:43943899-43943921 TTTGTAGTCCCCTGGTTTGAGGG - Intergenic
907445716 1:54506586-54506608 TTGCTAGTTCGCAGTTTTGATGG + Intergenic
909575430 1:77170727-77170749 TTGTTACTCACCAGTTTTAATGG - Intronic
918424650 1:184395904-184395926 GTGTTAGTCCCCAGTATTTTTGG - Intronic
919126370 1:193397828-193397850 TTGTTAATTCACAGTTTTGTGGG - Intergenic
921827303 1:219687558-219687580 TTGTTACTCCTCAGTTTAGCAGG - Intronic
923515405 1:234694005-234694027 TTGGTTGTCCTCAGTATTGAAGG + Intergenic
923852166 1:237808226-237808248 TTGTGTGTCCCCAGATTTCAGGG + Intronic
923970977 1:239202899-239202921 CTGTAAGTCCCCAGATTAGAAGG - Intergenic
1063503880 10:6579591-6579613 AGGTTATTCCCCAGCTTTGAGGG - Intronic
1069031892 10:63605370-63605392 AGGTTAGTTCCCAGTTTTTAGGG - Intronic
1069345254 10:67462016-67462038 TTTGTAGTCACCAGTTTTGTAGG + Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1071863712 10:89702325-89702347 CTGTCATTCCCCAGTTTAGAAGG + Intronic
1075687126 10:124371954-124371976 TTGTGAGGCCCCAGTGCTGATGG + Intergenic
1078637888 11:13068875-13068897 TTGGAAGTCCCCAGGCTTGAGGG - Intergenic
1082711855 11:56561990-56562012 TTGTAATCCCCCAGTTTTGGAGG + Intergenic
1086535054 11:87834399-87834421 TTATTACCTCCCAGTTTTGAAGG - Intergenic
1088859244 11:113784463-113784485 TTGTTAGCCACCTGCTTTGAAGG + Intergenic
1090996828 11:131874079-131874101 GTGTTAGTCCCAAGCCTTGATGG + Intronic
1091004933 11:131944363-131944385 TTGGGAGGCCCCAGTTTTGCAGG + Intronic
1091175510 11:133554205-133554227 ATATTAGGCCCCAGTTTTGTGGG - Intergenic
1094574617 12:31673911-31673933 TTGTTATTGTACAGTTTTGAAGG + Intronic
1095369344 12:41448111-41448133 TTGTCACTCCCCACTTTTGAGGG + Intronic
1095480208 12:42626756-42626778 TTGTTTTTCCCCATTTTTTACGG - Intergenic
1098059194 12:66541726-66541748 TTATTAGTGACCACTTTTGATGG + Intronic
1102643159 12:114384165-114384187 TTGTGAGTCCACAATCTTGAAGG + Intronic
1104770374 12:131357998-131358020 TTGTTAATCCCCAGTGTTGGAGG + Intergenic
1105754097 13:23449019-23449041 TTGTTAATCCACAGCTTTGCAGG - Intergenic
1107152829 13:37131717-37131739 TTGTTAGCCCACAGTTCTGTTGG - Intergenic
1110015449 13:70394496-70394518 TTGTTTCCCCCCAGTTTTGCAGG - Intergenic
1111479786 13:88809883-88809905 ATTTTAGTCCCCAGTGTTGGAGG + Intergenic
1114666268 14:24378846-24378868 TGGTTTGTCCCCTGTCTTGATGG + Exonic
1114738622 14:25070054-25070076 CTGTTAGCCCCCAGTTCTGTGGG + Intergenic
1115094972 14:29623405-29623427 TTTTTAATTCCCAGTTTTAACGG - Intronic
1117501089 14:56352065-56352087 GTGTTAGTCACCAGCTTTGTGGG + Intergenic
1121964991 14:98295779-98295801 TTCTAAGTCCCCAGTGTTGGAGG + Intergenic
1126490800 15:49233377-49233399 TTGTGATTCCCCAGTGTTGGAGG - Intronic
1127648407 15:60982095-60982117 TTATTAGTTCCAAGTGTTGAAGG - Intronic
1129785827 15:78309480-78309502 TGGTTCCTGCCCAGTTTTGAAGG - Intergenic
1129996254 15:80009048-80009070 CTGTTTGTGCCCAGTTCTGAGGG - Intergenic
1130576126 15:85094718-85094740 CTGTTAAACCCCTGTTTTGAGGG + Intronic
1133646976 16:7773738-7773760 TTGTAATCCCCCAGTGTTGAAGG - Intergenic
1136448716 16:30340083-30340105 TTCTCAGTCTCCAGGTTTGATGG - Intergenic
1137903718 16:52297458-52297480 GTGTAAGTCCCCAGTGGTGAAGG + Intergenic
1138337821 16:56267005-56267027 TGCTTAGTCCTCAGTCTTGATGG + Intronic
1139237126 16:65351591-65351613 AGGTGAGTCCCCAGTTTTGAAGG - Intergenic
1140584340 16:76271226-76271248 ATGTTAGTCCACAGTTTTCCTGG - Intergenic
1141085627 16:81093498-81093520 TTGTTGGCCCCAAGTTTAGAGGG + Intronic
1141355243 16:83339429-83339451 ATATTACTCCCCAGTTTTTAGGG - Intronic
1142047146 16:87932780-87932802 TTCTCAGTCTCCAGGTTTGATGG + Intronic
1143359518 17:6357266-6357288 TTTTTAGTGCGCAGTTTTGCAGG + Intergenic
1146253524 17:31373034-31373056 TTGTTAGGCCCAGGTTTTGGAGG + Intronic
1149210784 17:54297870-54297892 TTGTTATTCCAGAGTTTTAAGGG - Intergenic
1150909410 17:69372163-69372185 TTGATTGTCCCCAGATTTGGGGG - Intergenic
1151687737 17:75658997-75659019 TTGTTAAGAGCCAGTTTTGAAGG - Intronic
1154006325 18:10530607-10530629 TTGTTAGGCCTAAGTTTGGATGG + Intronic
1155678784 18:28463669-28463691 ATTTTAATCCCCAGTTTTGGAGG - Intergenic
1156141539 18:34117643-34117665 ATTTTAGTCCTCAGTTTTGCTGG - Intronic
1156869925 18:41933803-41933825 TTGTTAGACGCCAGATTTGGGGG + Intergenic
1157595895 18:48863391-48863413 TAGTTAGTTCCCAGTTTTGGGGG - Intergenic
1160213646 18:76906713-76906735 TTGTTTGTCATCAGTTTCGAGGG + Intronic
1161759683 19:6161855-6161877 TTTTTAGCCACCAGTTTTGGTGG - Intronic
1164545701 19:29160689-29160711 TTGTTTGCCCACATTTTTGATGG - Intergenic
1166964579 19:46520943-46520965 TTGTTAGTAGCCATCTTTGAAGG + Intronic
925371764 2:3350426-3350448 ATTGTAATCCCCAGTTTTGAGGG - Intronic
925992471 2:9264441-9264463 TTATGAGTCCCCAGCTCTGACGG + Intronic
927530369 2:23792389-23792411 TTGTTAGTCCCCAGTTTTGAAGG + Intronic
928090196 2:28369105-28369127 TTCTTAGTTCCCAGTTTAAATGG + Intergenic
930553852 2:52870409-52870431 ATTGTAGTCCCCAGTGTTGAAGG + Intergenic
933060271 2:77727755-77727777 GAGTTAGTACCCAGATTTGATGG + Intergenic
933586232 2:84182214-84182236 TTGTTATTCCACAGTTCTGTAGG - Intergenic
935676319 2:105597671-105597693 TTGTTAGTCCTCAATTTGGAGGG - Intergenic
940514997 2:154672346-154672368 TTGTTGGTCACAAATTTTGAAGG - Intergenic
941122504 2:161546896-161546918 ATTGTAGTCCCCAGTGTTGAAGG - Intronic
941198089 2:162475042-162475064 TTGTTACCCCACAGTTTTTATGG - Intronic
941822714 2:169858491-169858513 TTATTTCTCCTCAGTTTTGAAGG + Intronic
942153560 2:173104021-173104043 TTCTTATTCCCCACATTTGAAGG - Intronic
943246267 2:185455529-185455551 TTGGTAGTCAACACTTTTGAAGG + Intergenic
943961917 2:194275349-194275371 TTGTTAGTCCTGAGTGTTGCTGG + Intergenic
948251044 2:236529273-236529295 TTGTAATCCCCCAGTGTTGAGGG - Intergenic
948592217 2:239058333-239058355 TTGTTTGTCCCCAGTTTCTGTGG - Intronic
1169977704 20:11349024-11349046 TTGGTAATCCCCAGTGTTGGAGG + Intergenic
1170525453 20:17231671-17231693 TTGTTATTTCACAGTTTTCATGG + Intronic
1175454636 20:59102722-59102744 GTCTGACTCCCCAGTTTTGAGGG + Intergenic
1175649103 20:60701863-60701885 ATTTTAATCCCCAGTTTTGGAGG + Intergenic
1176370293 21:6058309-6058331 TGGGAACTCCCCAGTTTTGAGGG + Intergenic
1176988563 21:15466065-15466087 TAGTTAGTTCACAGTTTTGCAGG + Intergenic
1177220341 21:18184678-18184700 TTGCAAGTCCCCAGATTTGAAGG + Intronic
1177254521 21:18643917-18643939 TTATTAGTCACTAGTTGTGATGG - Intergenic
1178126911 21:29526034-29526056 TTTGTAATCCCCAGTGTTGAGGG - Intronic
1178320955 21:31605353-31605375 ATGGTAATCCCCAGTGTTGAAGG + Intergenic
1178642045 21:34352603-34352625 TTGTAATTCCCCAGTGTTGGAGG + Intergenic
1179753226 21:43480232-43480254 TGGGAACTCCCCAGTTTTGAGGG - Intergenic
1182656846 22:31897521-31897543 TTGTTAGTCCCAGTTTTGGAGGG + Exonic
1182868196 22:33623295-33623317 TTGTTTCTCTGCAGTTTTGAAGG - Intronic
1183032684 22:35117512-35117534 TTGTCAGTCCACAGGTATGAGGG - Intergenic
1183772319 22:39937663-39937685 TCCTTAGTCCCCAGTGTTGCAGG - Intronic
949595372 3:5538743-5538765 ATTTTAATCCCCAGTTTTGGAGG - Intergenic
955988268 3:64597937-64597959 TTGTTAGTTCCAGGTTCTGAAGG + Intronic
956069322 3:65431045-65431067 TTCCTAGGCCCCAGTGTTGATGG + Intronic
956198688 3:66681773-66681795 TTATTAGTTTCCAGTTTTCAAGG + Intergenic
957846052 3:85737070-85737092 TTGTTGGTCTCCAGTACTGATGG - Intronic
958008758 3:87847759-87847781 TTTTTAGTCCCCACATGTGAGGG + Intergenic
959196274 3:103187113-103187135 TTATTAGCTCACAGTTTTGAAGG - Intergenic
961212016 3:125132735-125132757 TTTGGAGTCACCAGTTTTGAGGG + Intronic
969459127 4:7318539-7318561 CTCTTCGTGCCCAGTTTTGATGG + Intronic
970707382 4:18821576-18821598 ATGTGATTCCCCAGTTTTGAAGG + Intergenic
970729434 4:19085762-19085784 TTCTTAAACCTCAGTTTTGATGG + Intergenic
974815103 4:66994214-66994236 TTGTAATTCCCAACTTTTGAGGG - Intergenic
974982639 4:68979040-68979062 TTCAAAGTCCCCACTTTTGAGGG - Intergenic
975017915 4:69446975-69446997 TTCAAAGTCCCCACTTTTGAGGG + Intergenic
976987939 4:91326493-91326515 TTGTTATCCCCCAGTGTTGAAGG - Intronic
977319903 4:95500250-95500272 TAGATGGTCTCCAGTTTTGAAGG + Intronic
978322536 4:107514395-107514417 ATTTTGGTCCCCAGTGTTGAAGG + Intergenic
981356758 4:143798421-143798443 TTTGTAGTTCCCAGTTTTGGGGG - Intergenic
981378083 4:144039303-144039325 TTTATAGTTCCCAGTTTTGGGGG - Intergenic
983585332 4:169348272-169348294 TTGTAATTCCCCAGTGTTGGAGG - Intergenic
984943064 4:184951139-184951161 TTGTTAGTGCGCACTTTTGGTGG - Intergenic
986424346 5:7615196-7615218 ATTGTAGTCCCCAGTGTTGAAGG - Intronic
989503448 5:42197129-42197151 ATTTTAATCCCCAGTGTTGAAGG + Intergenic
992125922 5:73641327-73641349 CTTTTAGTCACCAGGTTTGAAGG - Intronic
993767244 5:91876087-91876109 TTGTTAGTTTCTAGTTTGGATGG - Intergenic
994589425 5:101755000-101755022 ATTTTAATCCCCAGTTTTGGAGG + Intergenic
994712927 5:103287399-103287421 TTGTTAGTACAAATTTTTGATGG - Intergenic
997948996 5:138226996-138227018 TTGTTACTTCCAAGTTTTAAAGG + Intergenic
1002423599 5:179163259-179163281 TTGTGTTTTCCCAGTTTTGAAGG + Intronic
1002658677 5:180774355-180774377 ATGTGATTCCCCAGTATTGAAGG - Intergenic
1002850365 6:989761-989783 ATTTTAGTCCCCAGTGTTGGAGG - Intergenic
1004866670 6:19859575-19859597 CTGTCTCTCCCCAGTTTTGAAGG - Intergenic
1005409110 6:25523750-25523772 TTTCCAGTCCCCAGTTTTCAGGG - Intronic
1005732789 6:28714922-28714944 TTGTTAGACCAAACTTTTGATGG - Intergenic
1006688459 6:35858531-35858553 TTTATAGTTTCCAGTTTTGATGG - Intronic
1007536026 6:42589700-42589722 TTGTTTGTACTCATTTTTGAAGG + Intronic
1012664101 6:101943976-101943998 TTGTAATTCCCATGTTTTGAAGG + Intronic
1016224847 6:141722782-141722804 ATCGTAGTCCCCAGTGTTGAAGG + Intergenic
1016472215 6:144386659-144386681 TTTTTAGCCCTGAGTTTTGAAGG + Intronic
1018023625 6:159787429-159787451 TTGGTATTCACAAGTTTTGAGGG - Intronic
1019840435 7:3437271-3437293 TTGTTATTTCCCAGATTTGAGGG + Intronic
1024083986 7:45878525-45878547 GTGTAAGCCCCAAGTTTTGATGG - Intergenic
1028047124 7:86135739-86135761 TTGTTAGACCTCAGTTTGTAAGG - Intergenic
1029030431 7:97460966-97460988 ATTGTAGTCCCCAGTGTTGAGGG - Intergenic
1030648793 7:112094722-112094744 TTGTAACTCCCCAGTGTTGGAGG + Intronic
1031059138 7:117029442-117029464 TTCTTATTACCGAGTTTTGAAGG + Intronic
1031299370 7:120044096-120044118 CTGTAAGTCCTCAATTTTGAGGG + Intergenic
1034211879 7:149370963-149370985 TTGTTGTTTTCCAGTTTTGAGGG + Intergenic
1034529422 7:151686329-151686351 TTGTTAGTTCCCATTCTTTATGG + Intronic
1035405380 7:158593657-158593679 TTGTTAGTCCCCAGGCAGGAAGG + Intergenic
1036938238 8:13026099-13026121 CTGTGAGCCCCCAGTTTTGGAGG + Exonic
1037567974 8:20133637-20133659 TTGGAATTCCCAAGTTTTGAGGG - Intergenic
1041298602 8:56388230-56388252 TTGGAAGTCACCAGTGTTGAGGG + Intergenic
1041655655 8:60347669-60347691 TTTTTAGTCCCTAGTATTAAAGG - Intergenic
1041903872 8:63010390-63010412 ATGATTGACCCCAGTTTTGAGGG - Intergenic
1042328538 8:67554491-67554513 ATTTTAATCCCCAGTATTGAAGG - Intronic
1042642011 8:70946665-70946687 TTGTTCAGGCCCAGTTTTGAGGG + Intergenic
1043492236 8:80761025-80761047 ATTGTAGTCCCCAGTGTTGAAGG - Intronic
1045261577 8:100579764-100579786 TTGTTCTTCGCCATTTTTGAGGG + Intronic
1045276263 8:100708560-100708582 TTGTCAGGCCACAGTTTTAAAGG - Intronic
1050134859 9:2451924-2451946 TTGGAAGTCTTCAGTTTTGATGG + Intergenic
1052497100 9:29240842-29240864 TTGATTGTCCCCAGATTTGTGGG + Intergenic
1056002574 9:82232483-82232505 TTGTTAATCTCCAGTGTTGTGGG - Intergenic
1059076160 9:111196178-111196200 TATTTTGTTCCCAGTTTTGAGGG + Intergenic
1060019423 9:120116265-120116287 ATTGTAATCCCCAGTTTTGAAGG + Intergenic
1060020520 9:120126458-120126480 TTGTTTGTCACCAGATATGATGG + Intergenic
1061839162 9:133347772-133347794 TTGTTTGTGCCCATTTTTGGCGG + Intronic
1186656222 X:11614576-11614598 TTGTTAATCCCCAGTGTTAGAGG - Intronic
1186850005 X:13570362-13570384 TTGTCAGTCGCTAGTTTTGCTGG + Intronic
1187201949 X:17143464-17143486 CTGATATTCCCCAGTTCTGAAGG + Intronic
1189011470 X:37049531-37049553 TTGTAATTCCCCCGTGTTGAGGG + Intergenic
1189703335 X:43734305-43734327 TTGGTATTCCCCAGTTTCCAAGG - Intronic
1190431569 X:50382711-50382733 TAGTTAGTGCCCAGTGTGGAGGG - Intronic
1193564176 X:83057024-83057046 TAGTTACTCACCAATTTTGATGG - Intergenic
1193958949 X:87900076-87900098 TAGTTACTACCCAGCTTTGAAGG - Intergenic
1194269376 X:91791545-91791567 GTTTTAATCCCCAGTGTTGAAGG - Intronic
1199639204 X:149843309-149843331 TTGTGATTCCCCAGTGTTGGAGG - Intergenic
1200586596 Y:5012530-5012552 GTTTTAATCCCCAGTGTTGAAGG - Intronic