ID: 927541768

View in Genome Browser
Species Human (GRCh38)
Location 2:23918511-23918533
Sequence CAGTGTGTAGGGAGAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1068
Summary {0: 1, 1: 0, 2: 2, 3: 81, 4: 984}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927541768_927541772 -8 Left 927541768 2:23918511-23918533 CCTGCTCCTCTCCCTACACACTG 0: 1
1: 0
2: 2
3: 81
4: 984
Right 927541772 2:23918526-23918548 ACACACTGCCTCCTGAAATCAGG 0: 1
1: 1
2: 1
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927541768 Original CRISPR CAGTGTGTAGGGAGAGGAGC AGG (reversed) Intronic
900283951 1:1890600-1890622 CGGGGTCTAGGGAGAGGAGCCGG - Intronic
900763999 1:4491750-4491772 CTGTGTGCAGGAAGAAGAGCAGG + Intergenic
901201841 1:7471620-7471642 CAGTGGGTCAGGGGAGGAGCAGG + Intronic
902148191 1:14420873-14420895 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
902334827 1:15748767-15748789 CAGAGGGTAGGCAGAGGAGCTGG - Intergenic
902363735 1:15957361-15957383 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902363745 1:15957400-15957422 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902363754 1:15957439-15957461 CGGTGTATCTGGAGAGGAGCAGG + Intronic
902641520 1:17769278-17769300 CAGAGTGTAGGGAGAGGGTCTGG + Intronic
902816039 1:18917322-18917344 CACAGTTTGGGGAGAGGAGCAGG + Intronic
903193552 1:21669397-21669419 CAGTGAGTGGGGAGCGGCGCCGG - Intergenic
903479888 1:23645350-23645372 CAGACTGTGGGTAGAGGAGCAGG + Intergenic
903502647 1:23809900-23809922 CAGGGTGCAGGGGAAGGAGCAGG + Intronic
903624569 1:24721515-24721537 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904238913 1:29131448-29131470 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
904330533 1:29755454-29755476 CAGTGTCTGGGGAGAGAAGATGG + Intergenic
904392883 1:30197372-30197394 CAGTGGGTAAGGGGTGGAGCAGG - Intergenic
904416144 1:30362140-30362162 CAGTGTCTGGGGAGAGAAGATGG - Intergenic
904601061 1:31672846-31672868 CAGGGAGTGGGGAGAGGAGTGGG + Intronic
904823790 1:33261789-33261811 AAGTGGGAAGGGAGAGGAGCAGG + Intronic
905345729 1:37309819-37309841 CAAAGGGTAGGGAGAGGAGAGGG - Intergenic
905510954 1:38519737-38519759 CAGGCTGAAGGGAGAGGAGAAGG + Intergenic
905908283 1:41634391-41634413 CACTGTGTGGGGAGAGGGGAAGG + Intronic
905951434 1:41954732-41954754 CAGCCTGTAGGCAGAGGAGCTGG - Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906192294 1:43905942-43905964 GAGAGTGGTGGGAGAGGAGCAGG - Intronic
906192437 1:43906448-43906470 GAGAGTGGTGGGAGAGGAGCAGG - Intronic
906393369 1:45438674-45438696 TAGAGTGGAGGGAGAGGATCAGG - Intronic
906451247 1:45950078-45950100 GAGAGAGGAGGGAGAGGAGCAGG + Intronic
906688807 1:47779340-47779362 GTGTGTGTGGGGAGAGGGGCTGG + Intronic
906963534 1:50434396-50434418 CAGGTAGTAGGGAGAGGAGCTGG - Intergenic
907053099 1:51342963-51342985 CAGTGTGCAGGGAGAGCAGAGGG - Intronic
907309563 1:53531413-53531435 CGGGGAGTAGGGGGAGGAGCTGG + Intronic
907371180 1:54004594-54004616 AGGTGTGTAGGGAGAGGCGTGGG - Intergenic
907537000 1:55171876-55171898 CACTGTGAAGGAAGAGGAGGAGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908963042 1:69725242-69725264 CATTGAGTAGGGGGAGGAGGAGG + Intronic
909335207 1:74465270-74465292 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
909608764 1:77532094-77532116 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
910248058 1:85163761-85163783 CAGTGTGGGGTGAGAGTAGCAGG + Intronic
910334301 1:86110549-86110571 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
910478856 1:87636597-87636619 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
910693171 1:89984988-89985010 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
911001420 1:93170258-93170280 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
911659932 1:100489905-100489927 CATTTTGTAGGGAGATGGGCTGG + Intronic
912321720 1:108719987-108720009 CAGAATGTAGGGAGAAGAGAGGG + Intronic
912474054 1:109924570-109924592 AAGGGTGTGGGGAGAGGAGAGGG + Intronic
912581789 1:110727572-110727594 CAGTATGCAGGGACAGAAGCAGG + Intergenic
912671492 1:111632085-111632107 CAGTCTGTGGGGAGTGGGGCAGG + Intronic
912801691 1:112723432-112723454 AAGTGTGTGGGGAGAGGAGTGGG - Intronic
913973147 1:143431922-143431944 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
914067531 1:144257529-144257551 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
914111622 1:144708825-144708847 CTGTCTCTGGGGAGAGGAGCAGG + Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914755009 1:150557525-150557547 CCGTGAGTCGGGAGAGGAACTGG + Exonic
914901305 1:151712531-151712553 CAGGGTGAAGGGGGAAGAGCTGG + Intronic
915078910 1:153337932-153337954 AGGTGTGGAGGGAGAGCAGCTGG - Intronic
915233265 1:154461845-154461867 CAGGGTGTAGGGTGAGGTCCTGG + Intronic
915287349 1:154861504-154861526 GAGTGTGTAGGGAATAGAGCAGG - Intronic
915662118 1:157413138-157413160 CAGTGTTTTGGGAGAGGAAATGG + Intergenic
915681152 1:157583093-157583115 CAGTGAGTAAGTTGAGGAGCTGG - Intronic
916115012 1:161479031-161479053 AAGTGTGGAGGGAGAGGCACGGG + Intergenic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916841668 1:168607846-168607868 ATGGGGGTAGGGAGAGGAGCAGG + Intergenic
917169804 1:172158509-172158531 CAGTGTGCAGTGAGAAGAGAGGG + Intronic
917348906 1:174056743-174056765 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
917406257 1:174711208-174711230 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
917528705 1:175813309-175813331 GAGGGTGGAGGGAGAGGATCAGG + Intergenic
917709538 1:177670494-177670516 CAGTAGGTAAGGAGAGGTGCAGG - Intergenic
917838763 1:178960904-178960926 AAGTGTGCAGGGAGTGGAGTGGG + Intergenic
917839970 1:178969663-178969685 GAGTGTGTTGGGGCAGGAGCAGG + Intergenic
918002205 1:180508591-180508613 AGGTGTGGAGGGAGAGGAGCAGG + Intergenic
918033250 1:180838294-180838316 CATTGTGTAGGCTGAGGAGGAGG + Intronic
918629246 1:186695811-186695833 CACTGAGTAGGCTGAGGAGCAGG - Intergenic
918793139 1:188857619-188857641 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
918951971 1:191151415-191151437 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
918993856 1:191731804-191731826 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
919049826 1:192499431-192499453 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
919250807 1:195054311-195054333 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
919297806 1:195723259-195723281 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
919361885 1:196607096-196607118 CAGTGTGTAGAGACAGGAGTTGG + Intronic
919494308 1:198245179-198245201 CATTGGGTAGGCAGAGGAGAAGG + Intronic
920347654 1:205317117-205317139 CAGGGTGTTGGCAGAGGAGTGGG - Intronic
920604900 1:207371767-207371789 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
920793375 1:209114095-209114117 CAATGAGTTGGGAGAAGAGCAGG + Intergenic
920859901 1:209697290-209697312 GAGTGTGTGGGGAGAGGGGAGGG - Intronic
921290346 1:213651074-213651096 CAGAGTGTAGGGAGAAAAGTGGG + Intergenic
922233456 1:223705635-223705657 CAGGGTGCTGGGAGAGGAGTTGG - Intronic
923172633 1:231431144-231431166 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
923193486 1:231642276-231642298 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
924444812 1:244119356-244119378 AAGTGAGGAGGGAGAGGAGATGG + Intergenic
1062980811 10:1720931-1720953 CTTTGTGCAGGGAGAGGAGGTGG - Intronic
1063113633 10:3057558-3057580 CATTGAGTAGGCAGAGGAGGAGG + Intergenic
1063309336 10:4937751-4937773 AGGTGTGGAGGGAGAGGTGCAGG - Intronic
1063343129 10:5287003-5287025 CACTGTGTAGGCTGAGGAGAAGG - Intergenic
1065668469 10:28087806-28087828 CAGTGAGGTGGGAGAGGAGCAGG + Intronic
1065752204 10:28897147-28897169 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1065895859 10:30162844-30162866 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1066083339 10:31954003-31954025 CTATGTGTTGGGGGAGGAGCTGG + Intergenic
1066234002 10:33468023-33468045 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1066235506 10:33480835-33480857 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
1066613636 10:37275695-37275717 AAGTGTGGAGGGAGAGGTGCAGG - Intronic
1067139918 10:43648507-43648529 CAGCGTCTGCGGAGAGGAGCAGG - Intronic
1068211297 10:53924172-53924194 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
1068216633 10:53990801-53990823 AGGTGTGGAGGGAGAGGTGCAGG + Intronic
1068300736 10:55135431-55135453 TTGTGTTTAGGGAGTGGAGCTGG - Intronic
1068460337 10:57321510-57321532 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1068461646 10:57337077-57337099 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1068554996 10:58448626-58448648 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1068830224 10:61485432-61485454 CAGGGGGTAGGGTGAGGAGGAGG + Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069988638 10:72300598-72300620 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1070173443 10:73950354-73950376 CAGTGTGCGGGGAGAGAATCTGG + Intergenic
1070183158 10:74033927-74033949 CAGTGTGAATGGAGATGAGAGGG - Intronic
1070371569 10:75787266-75787288 CAATGTGGAGGGAAAGCAGCAGG - Intronic
1070564103 10:77590558-77590580 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1070829291 10:79408812-79408834 CAGTGTGTAGGGACTGGGTCAGG - Intronic
1070893819 10:79964731-79964753 TAATGTGTAGGGAAGGGAGCGGG - Intronic
1070942596 10:80359860-80359882 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1070967978 10:80541414-80541436 AAATGTGTAGGGAGGGGACCAGG - Intronic
1071055668 10:81505816-81505838 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1071332150 10:84571190-84571212 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1071511977 10:86267754-86267776 AAGTGTGTGGGCAGAGGAGGAGG - Intronic
1071611045 10:87031335-87031357 TGGTGTGGAGGGAGAGGTGCGGG - Intergenic
1072278461 10:93845178-93845200 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1072433548 10:95395070-95395092 GAGTGTCTAGGCAGAGGAGCAGG + Exonic
1072563252 10:96596335-96596357 CAGTGAGGAGGCAGAGGAGCAGG - Intronic
1072713509 10:97734208-97734230 CACTGTCTAGAGAGAGGAGGAGG + Intergenic
1073103302 10:101018376-101018398 CAGAGAGAAGGGAGAGGAGAGGG + Intronic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1074208453 10:111305170-111305192 CTGTGTGTTGGGGGAGGGGCAGG + Intergenic
1074316971 10:112369777-112369799 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1074365521 10:112854750-112854772 CAGTATGTAGGGAGAGCAATCGG + Intergenic
1074996386 10:118760518-118760540 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG + Intergenic
1075196224 10:120361485-120361507 GAATGAGTAGGGAGATGAGCAGG + Intergenic
1075305683 10:121365567-121365589 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1075712135 10:124536450-124536472 CAGGGTGGAGGGAGAGGGGCCGG - Intronic
1076980138 11:199757-199779 CAGTGTCTAGGGAAAAGGGCAGG - Intronic
1077126764 11:942949-942971 CAGTGAGCGAGGAGAGGAGCTGG + Intronic
1077147056 11:1051038-1051060 CACTGAGAAGGGAGAGAAGCTGG - Intergenic
1077366351 11:2162846-2162868 GAGTGTGTAGGGAGGGAGGCTGG + Intergenic
1077371614 11:2184801-2184823 GAGTGTGACGGGAGAGGTGCTGG - Intergenic
1077372739 11:2191132-2191154 CAGTGTGCAGGGGGCAGAGCCGG + Intergenic
1077376626 11:2208290-2208312 CAGTGAGTGGGGAAAGGTGCAGG + Intergenic
1078605981 11:12776007-12776029 CAGTGGGCAGGGAGGGGTGCAGG + Intronic
1079191017 11:18276463-18276485 CGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1079248849 11:18772857-18772879 CCGTGTGCGGGGAGACGAGCAGG + Intronic
1080687081 11:34524735-34524757 GAGTGTGCAGGGAGAGGAAAGGG - Intergenic
1081047728 11:38296648-38296670 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1082106694 11:48228899-48228921 AGGTGTGGAGGGAGAGGAGTGGG + Intergenic
1082734886 11:56845187-56845209 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1083074331 11:60020587-60020609 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
1083162310 11:60862274-60862296 CAGTGGGTGAGCAGAGGAGCTGG + Intergenic
1083549298 11:63574265-63574287 CAATGTGGGAGGAGAGGAGCAGG + Exonic
1083711267 11:64550470-64550492 GTGAGTGGAGGGAGAGGAGCAGG - Intergenic
1083894130 11:65611696-65611718 CAGTGGGGAGGGTGGGGAGCAGG + Intronic
1084106461 11:66983993-66984015 CAGGGAGCAGGGAGAGGAGATGG - Intergenic
1084161970 11:67355023-67355045 CAGAGGGGAGGCAGAGGAGCAGG + Intronic
1084173600 11:67412121-67412143 CAGTGTGTGGGGACTGAAGCTGG + Intronic
1084210418 11:67619029-67619051 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1084266826 11:68009276-68009298 CAGGGCGCTGGGAGAGGAGCAGG + Intronic
1084446129 11:69204662-69204684 GAGGGTGGAGGGAGAGCAGCAGG + Intergenic
1084694661 11:70746328-70746350 GAGTGTGGTGGGAGAGGAGATGG - Intronic
1084694692 11:70746427-70746449 GAGTGTGGTGGGAGAGGAGATGG - Intronic
1084953715 11:72680386-72680408 AAGAGTGTAGGGGGAGGATCTGG - Intergenic
1085280460 11:75326683-75326705 CAGTGTGTAGTAAGAGGGGATGG - Intronic
1085732493 11:79011566-79011588 AAGAGTGTAGGCAGAGGATCTGG - Intronic
1085902215 11:80714613-80714635 GAGGGTGGAGGGAGAGGATCAGG + Intergenic
1086001123 11:81987046-81987068 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1086210158 11:84308906-84308928 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1086311019 11:85536611-85536633 AAGTGTGAAGAGAGAGGCGCAGG + Intronic
1087682380 11:101231706-101231728 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1087683836 11:101241620-101241642 AAGTGTGGAGGGAGAGGGGCAGG - Intergenic
1087977298 11:104565305-104565327 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088783083 11:113155147-113155169 CAGTGAGGAAGGAGAGGAACTGG + Intronic
1089045654 11:115500840-115500862 GAGTGTGGAGAGAGATGAGCAGG + Intronic
1089588516 11:119525000-119525022 CAGTGTGGAGGGAAGGCAGCTGG - Intergenic
1089666823 11:120025888-120025910 AAGTGTGGAGGGAGAGGCACGGG + Intergenic
1090588222 11:128237080-128237102 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1090768025 11:129894232-129894254 CACTTTGTAGGAATAGGAGCTGG - Intronic
1090782688 11:130021662-130021684 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1091058224 11:132438699-132438721 CAGGGTGTAGGGTGTGCAGCAGG + Intronic
1091402282 12:188445-188467 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
1091467977 12:702194-702216 CAGAATGCAAGGAGAGGAGCGGG - Intergenic
1091848530 12:3676908-3676930 AAGAGTGTTGGAAGAGGAGCAGG - Intronic
1091917014 12:4277006-4277028 CAGTGAGGAGGGGGAGGGGCGGG - Intronic
1092126724 12:6079897-6079919 CAGTGTGTGAGGTGGGGAGCAGG - Intronic
1092133925 12:6132607-6132629 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1092366510 12:7881269-7881291 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1092545894 12:9450755-9450777 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1092732433 12:11547282-11547304 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1093346234 12:18040244-18040266 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1093524812 12:20093634-20093656 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1093583307 12:20807800-20807822 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1093793683 12:23285935-23285957 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1094108751 12:26839168-26839190 GGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1094327525 12:29256633-29256655 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1094507062 12:31071318-31071340 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1094573404 12:31662050-31662072 CAGTGTCCCTGGAGAGGAGCTGG + Exonic
1095375299 12:41520078-41520100 CAGTGTGGAGGAAGAGAAGAGGG - Intronic
1095478642 12:42611148-42611170 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1095533939 12:43224312-43224334 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1095605324 12:44060627-44060649 AAGTATGTCTGGAGAGGAGCAGG + Intronic
1096196181 12:49650224-49650246 TTTAGTGTAGGGAGAGGAGCAGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097493511 12:60298947-60298969 GAGGGTGGAGGGAGAGGATCAGG - Intergenic
1097547539 12:61023403-61023425 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1097733080 12:63151267-63151289 CACTGTGGAGGGGGTGGAGCTGG + Intergenic
1097981976 12:65744349-65744371 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1098009662 12:66037119-66037141 CAGGGTGGAGGGATAGGAGTAGG + Intergenic
1098209879 12:68152356-68152378 CAGTGTGTAGGGAGGAAACCTGG - Intergenic
1098298515 12:69029141-69029163 CAGTGTGCAGGGGAAGGAGGGGG - Intergenic
1098778712 12:74655638-74655660 CAGGGTGGTGGGAGAGGATCAGG + Intergenic
1099192408 12:79573908-79573930 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1099640994 12:85283765-85283787 CAGTTTGCAGCTAGAGGAGCTGG + Exonic
1100078881 12:90824052-90824074 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100377891 12:94034371-94034393 CAGTGTGTAGGGGGTGGGGTGGG - Intergenic
1100600605 12:96108894-96108916 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1100734658 12:97513108-97513130 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1100854627 12:98748253-98748275 CAGTTTGCAGGGTGGGGAGCGGG + Intronic
1100895788 12:99180910-99180932 CAGTCAGTAGGGAGGGGAGGAGG - Intronic
1101578881 12:106023649-106023671 AAGTGCTTAGGCAGAGGAGCAGG + Intergenic
1101783813 12:107864324-107864346 AAGTGTGAAGAGAGAGGCGCGGG + Intergenic
1101957108 12:109221625-109221647 CAATGTGTAGGGGAAGGAGCGGG + Intronic
1102387273 12:112520260-112520282 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1102518575 12:113465623-113465645 CAGCGCGCAGGGAGAGGAGGCGG + Intronic
1102565408 12:113794378-113794400 CACTGTGCATGGAGAGGAGGAGG - Intergenic
1102567881 12:113808912-113808934 GGGTGTGGAGGGAGAGGAGGTGG + Intergenic
1102753149 12:115313808-115313830 CAGTGAGTGGGGATGGGAGCTGG - Intergenic
1102760348 12:115379782-115379804 CAGTGAATAGGGAGAAGAGCCGG + Intergenic
1103198549 12:119067772-119067794 TAATGTGTAGGTGGAGGAGCTGG - Intronic
1103507427 12:121451171-121451193 CATTGTGTAGGCAGAGGAGGAGG - Intronic
1103739380 12:123081154-123081176 CAGTGTCTGGGCAGGGGAGCAGG + Intronic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1104373839 12:128247237-128247259 AGGTGTGGAGGGAGAGGTGCAGG + Intergenic
1104649705 12:130522699-130522721 CTGTGCGCAGGGAGAGGAGGAGG + Intronic
1104872086 12:132007154-132007176 CAGTGTGTGGGCAGCAGAGCAGG + Intronic
1105237198 13:18568085-18568107 AAGTGTGAAGAGAGAGGCGCGGG - Intergenic
1105443948 13:20436669-20436691 CAGTGAGTGGGGAAAGGCGCTGG - Intronic
1105923775 13:24988081-24988103 CAGTCTGTAGGGGGAGGGACAGG - Intergenic
1106097467 13:26660618-26660640 AAGAGTGTAGGGTGAGGAGCAGG + Intronic
1106163339 13:27219753-27219775 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1106465974 13:30015002-30015024 CAGTATGAAGGAAGGGGAGCTGG + Intergenic
1107097191 13:36549673-36549695 CTGTTTGTAGGGAGAGGGGATGG - Intergenic
1107284863 13:38779674-38779696 GAGTGTGTGAGGAGAGGAGCAGG - Intronic
1107400434 13:40063860-40063882 CTGTGTGGAGTGGGAGGAGCAGG + Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107755234 13:43614606-43614628 CAGTGAGCAGGGAGAGAAGGAGG - Intronic
1107988885 13:45799699-45799721 CTGCTTGCAGGGAGAGGAGCGGG - Intronic
1108362335 13:49678650-49678672 AGGTGTGGAGGGAGAGGCGCCGG - Intronic
1108644018 13:52408446-52408468 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
1108855515 13:54788010-54788032 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1108856560 13:54800049-54800071 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1108868534 13:54952317-54952339 CATTGAGTAGGCAGAGGAGGAGG - Intergenic
1108991175 13:56659480-56659502 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1109152157 13:58859225-58859247 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1109563199 13:64077865-64077887 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1109854339 13:68108086-68108108 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1109858790 13:68170969-68170991 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1109884346 13:68523932-68523954 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1110854239 13:80278989-80279011 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1110913969 13:80998799-80998821 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1111333531 13:86792254-86792276 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1111556212 13:89884197-89884219 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1111625096 13:90774781-90774803 CAGTGTGGAGGGTGAGGTCCTGG - Intergenic
1111747649 13:92290878-92290900 AGGTGTGGAGGGAGAGGCGCTGG + Intronic
1112077796 13:95931807-95931829 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1112456966 13:99571908-99571930 CAGTGCCAAGGGAAAGGAGCTGG + Intergenic
1113330217 13:109319431-109319453 AAGTGTGGAGGGAGAGGCGTGGG - Intergenic
1113376446 13:109768786-109768808 CAGTCTGTAGAGAGAGGATGTGG - Intronic
1113743443 13:112726282-112726304 CTGTGTGCAGGGAGAGGGGCTGG + Intronic
1114160203 14:20157255-20157277 GTGGGAGTAGGGAGAGGAGCAGG - Intergenic
1114566326 14:23635791-23635813 AGGTGTGGAGGGAGAGGCGCCGG + Intronic
1114658396 14:24329700-24329722 TAGGGTGCAGGGAGGGGAGCTGG - Intronic
1114679536 14:24473139-24473161 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1115533270 14:34346170-34346192 AGGTGTGGAGGGAGAGGTGCGGG - Intronic
1116310970 14:43326594-43326616 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1116426485 14:44798579-44798601 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1116874780 14:50100119-50100141 CAGTGGGGAGGGAGAGCATCAGG - Intergenic
1116900926 14:50361945-50361967 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
1117565602 14:56991056-56991078 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1117742587 14:58833919-58833941 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1117837285 14:59819914-59819936 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1118306294 14:64658168-64658190 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1118389315 14:65282814-65282836 AAGGGGGTAGAGAGAGGAGCAGG - Intergenic
1118734150 14:68690184-68690206 GAGGGGGTAGGGAGAGGTGCTGG + Intronic
1118932329 14:70254710-70254732 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1119027745 14:71167529-71167551 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1119030465 14:71188331-71188353 CAGTGTGCAGTGAAGGGAGCTGG + Intergenic
1119031639 14:71197325-71197347 CAGTGGGGAGGTAGGGGAGCTGG - Intergenic
1119078829 14:71672790-71672812 CAGTGTGTGGTGACAGCAGCTGG + Intronic
1119266869 14:73267930-73267952 AAGTGAGTAGGGAGATGAACAGG - Intronic
1119303717 14:73590804-73590826 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1119415928 14:74469100-74469122 CATTGTGTAGGAAGAGGACCAGG + Intergenic
1120214710 14:81669082-81669104 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1120644172 14:87052598-87052620 CAGAGTGCAGGGACAGGGGCAGG + Intergenic
1120691902 14:87602092-87602114 GAGTGTGTAGAGAGAGGTGGAGG - Intergenic
1120767684 14:88344840-88344862 CAGTGAGTAGGCTGAGGAGGAGG + Intergenic
1120769889 14:88367545-88367567 CAGGGAGGAGGGAGAGGATCAGG - Intergenic
1120804233 14:88728606-88728628 CATTGTGTAGGCTGAGGAGGAGG + Intronic
1121145335 14:91577942-91577964 AAGTGTGGAGGGAGAGGCGCGGG + Intergenic
1121232621 14:92368914-92368936 GAGTGGGTAGGGAGCTGAGCAGG - Intronic
1121288821 14:92757871-92757893 CAGTGTCTGGGGAGGGGAACTGG - Intergenic
1121601995 14:95212320-95212342 CAGTCTGTACGCTGAGGAGCTGG + Intronic
1121788940 14:96684173-96684195 GAATGTGTAAGGAGAGGAGCAGG + Intergenic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1122404949 14:101495054-101495076 CAGGCTGTAGGGAGGGGCGCTGG + Intergenic
1122514497 14:102297675-102297697 AGGTGTGGAGGGAGAGGTGCAGG + Intronic
1122894858 14:104751856-104751878 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
1123007703 14:105332392-105332414 CAGTGGGGAGTGAGAGGAGCAGG + Intronic
1124061625 15:26298433-26298455 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1124110633 15:26781996-26782018 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1124659975 15:31539281-31539303 CAGTCTGTAGGGATAGGAAGGGG - Intronic
1124991323 15:34676890-34676912 CAGTGTGGTGGGAGAGCAGTGGG + Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125423500 15:39527502-39527524 CAGTGAGTAGAATGAGGAGCAGG - Intergenic
1125622173 15:41073266-41073288 CTGTGTGTAGGGGGTGGAGCTGG - Intronic
1126165568 15:45651375-45651397 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1126475939 15:49065243-49065265 AAGAGTGCAGGGAGAGAAGCAGG + Intergenic
1126639635 15:50811958-50811980 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1126997543 15:54462445-54462467 AGGTGTGGAGGGAGAGGTGCAGG + Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127368135 15:58310358-58310380 CTGTGTGGAGTGAGAGGAGGAGG + Intronic
1127954034 15:63836805-63836827 AAGTGTGGAGGCAGAGCAGCAGG + Intergenic
1128491003 15:68144384-68144406 CAGAGAGGAGGGAGTGGAGCAGG - Intronic
1128506373 15:68275915-68275937 AAGTGTGTTGGCAGAGGAGAGGG + Intergenic
1128659734 15:69490036-69490058 CAGTGTGGAGGGCAAAGAGCTGG - Intergenic
1129158301 15:73732516-73732538 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1129208600 15:74052528-74052550 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129724429 15:77894343-77894365 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1129820986 15:78601864-78601886 CAGTGAGGAAGGAGATGAGCAGG + Exonic
1130015546 15:80183386-80183408 CAGGGGGTAAGCAGAGGAGCGGG + Intronic
1130745862 15:86653311-86653333 CAGGGAGAAGGGAAAGGAGCAGG - Intronic
1131012741 15:89032024-89032046 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1131159334 15:90094350-90094372 CAGGCTGTGGGCAGAGGAGCAGG - Intronic
1131250225 15:90825511-90825533 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1131472863 15:92711388-92711410 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1131786229 15:95914003-95914025 CACTGTGTAGGGAGGGGGGATGG + Intergenic
1131846162 15:96492208-96492230 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
1131892209 15:96984480-96984502 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1131892224 15:96984530-96984552 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1131992417 15:98104594-98104616 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1132390770 15:101436676-101436698 CAGTGTGGAGGGAGAGGCCCAGG - Intronic
1132802946 16:1763138-1763160 CAGTGTGCAGGGAGAGGTCACGG - Intronic
1132836865 16:1958571-1958593 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133091477 16:3407703-3407725 CAGTCTGGATGGAGATGAGCTGG - Intronic
1133362685 16:5186692-5186714 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1133524056 16:6587176-6587198 CAGTGCGGAGAGAGGGGAGCTGG - Intronic
1133750569 16:8722140-8722162 CAGTCTCTAGGGAAAGGAGGGGG + Intronic
1134030771 16:10990605-10990627 CAGTGGGCAGGGATGGGAGCAGG + Intronic
1134678172 16:16104997-16105019 AGGTGTGGAGGGAGAGGAACGGG - Intronic
1135338984 16:21630320-21630342 AGGTGTGAAGGGAGAGGTGCAGG - Intronic
1135340075 16:21637732-21637754 AAGTGTGGAGGGAGAGGCACGGG - Intronic
1135734101 16:24917130-24917152 CAGGGGGTAGTGAGAGGAACCGG + Intergenic
1135967062 16:27044606-27044628 CAGTGTGCATGGGGAAGAGCAGG - Intergenic
1136105278 16:28025774-28025796 CAGTGTGTTGGGACAGAAGAGGG + Intronic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136417945 16:30114673-30114695 CAGTCTGGCGGGAGAGGGGCAGG + Exonic
1138426089 16:56932744-56932766 CTCTCTGCAGGGAGAGGAGCGGG + Intronic
1138608705 16:58105956-58105978 CAGTGTGCTGGCAGAGGGGCAGG - Intergenic
1138673453 16:58633746-58633768 TTGTCTGTAGGGAGAGGAGTGGG + Intergenic
1139202603 16:64993804-64993826 CAGAGTGGGGAGAGAGGAGCTGG + Intronic
1139352020 16:66342843-66342865 CAGTCTGCAGGAAGAGGAACGGG - Intergenic
1139676387 16:68526738-68526760 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140144627 16:72294707-72294729 CAGTGTCTGGGGGGAGGAGGGGG - Intergenic
1140302970 16:73775844-73775866 CAGAATTGAGGGAGAGGAGCAGG - Intergenic
1140693429 16:77507530-77507552 CAGGGTGGAGGGAGAGCAGGGGG + Intergenic
1140892405 16:79296374-79296396 CAGGGTGTAGGGAGAGCATCAGG + Intergenic
1141619131 16:85227576-85227598 CAGTCTCTTGGGAGAGCAGCGGG + Intergenic
1141837678 16:86553419-86553441 CGGTGTGGAGGGAGAGGCGCGGG + Intronic
1141845711 16:86607529-86607551 CTGTGTGTTGGGAGAGAAGGGGG - Intergenic
1141869199 16:86773092-86773114 CTGCGTTTTGGGAGAGGAGCAGG + Intergenic
1142173042 16:88632719-88632741 TAGAGTGTAGGCAGAGGAGCTGG + Intergenic
1142342442 16:89532335-89532357 CTGTTTGTAGGGAATGGAGCTGG + Intronic
1142475591 17:187223-187245 CAGTGTGGAGGGAGAGAGCCTGG - Intergenic
1142612513 17:1116947-1116969 CAGTCAGGAGGGAGTGGAGCAGG + Intronic
1142986377 17:3697464-3697486 CCAGGGGTAGGGAGAGGAGCAGG - Intergenic
1143031588 17:3971016-3971038 CAAATTTTAGGGAGAGGAGCCGG - Intergenic
1143135299 17:4709411-4709433 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143497461 17:7320715-7320737 CACTGTGGAGCGAGAGAAGCTGG + Intronic
1143598128 17:7927890-7927912 CAGTCTGGAAGGAGAGGAGCTGG - Intronic
1143680228 17:8470755-8470777 CTGTGCCTTGGGAGAGGAGCAGG + Intronic
1144103373 17:11963506-11963528 GAGGGTGTAGGGAGAGGTGGGGG + Intronic
1144128044 17:12220892-12220914 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1144163907 17:12588934-12588956 AAGGGAGGAGGGAGAGGAGCAGG + Intergenic
1144647759 17:16987157-16987179 CAGTGTTTAGTCAGAGCAGCTGG - Intergenic
1144875112 17:18393503-18393525 TAGTGTGCAGGCATAGGAGCGGG + Intergenic
1145050345 17:19654686-19654708 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1145094803 17:20016456-20016478 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1145157112 17:20550918-20550940 TAGTGTGCAGGCATAGGAGCGGG - Intergenic
1145244878 17:21262160-21262182 CTGCGTGTAGGGAGAGGATAGGG - Intergenic
1147417011 17:40299408-40299430 GAGGGTGGAGGGAGAGGATCAGG - Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147759859 17:42790529-42790551 GAGAGTGAAGGGAGATGAGCCGG + Intronic
1147816101 17:43211987-43212009 CTGTGTGTTGGGCGAGGAGGCGG - Intronic
1148023338 17:44568207-44568229 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1148051383 17:44771668-44771690 CAGTGAGTATGGGGAGGGGCCGG + Exonic
1148231434 17:45937673-45937695 AAGAGTGTGGGGAGAGGAGGCGG + Intronic
1148354728 17:46968267-46968289 CAGTGCGGAGGGAGAGGAAGAGG - Intronic
1148456093 17:47812305-47812327 CAGTGTCTAGGGAGGAGGGCAGG - Intronic
1149610847 17:57956663-57956685 AAGTGTGGGGAGAGAGGAGCAGG - Intergenic
1149856565 17:60088101-60088123 CAGTGTGTGTGGGGAGGAGAGGG - Intergenic
1149916351 17:60613604-60613626 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1149988707 17:61368232-61368254 CCCTGGGTATGGAGAGGAGCGGG + Intronic
1150433814 17:65139135-65139157 CAGGGTGGAGGAAGAGGACCTGG - Intronic
1150682475 17:67294740-67294762 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1150792208 17:68207848-68207870 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1151007575 17:70455684-70455706 CAGTGGGTGGGGAGAGGGGTAGG - Intergenic
1151575251 17:74949883-74949905 AGGTGTGTGGGGAGAGGAGCTGG - Exonic
1151778951 17:76229237-76229259 AAGTGTGAAGGAAGAGGAGAGGG - Intronic
1152137300 17:78512051-78512073 CAGTGTGGTGGGGGCGGAGCAGG + Intronic
1152678857 17:81655519-81655541 GAGGCTGTAGGGAGAGGAGGAGG - Intronic
1153092707 18:1366593-1366615 AAGTGTGGAGGGAGAGAAGGAGG - Intergenic
1154057285 18:11024016-11024038 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1154231468 18:12559457-12559479 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1154370905 18:13762321-13762343 TTGTGTTCAGGGAGAGGAGCTGG + Exonic
1154942987 18:21132826-21132848 AGGTGTGGAGGGAGAGGAGCGGG - Intergenic
1155593835 18:27459307-27459329 CAGTGAAGAGGGAGAGGATCAGG - Intergenic
1155806341 18:30175488-30175510 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1156079473 18:33316218-33316240 AGGTGTGGAGGGAGAGGCGCCGG + Intronic
1156131922 18:33987003-33987025 CAGTGGGTAGGGATTGGGGCAGG + Intronic
1156180076 18:34593046-34593068 CAGTGAGTAGGGGGAGGGGATGG + Intronic
1156193983 18:34752327-34752349 CATTCTGTAGGGAAAGGAGCAGG - Intronic
1156629093 18:38944773-38944795 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
1156657790 18:39309083-39309105 AGGTGTGGAGGGAGAGGTGCTGG + Intergenic
1157297483 18:46456783-46456805 CGGTGTCGAGGGAGAGGAGGGGG + Exonic
1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG + Intronic
1157807915 18:50672147-50672169 CAGGGTGCAGGGAGTGGAGAAGG + Intronic
1157935219 18:51864740-51864762 GGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1158282341 18:55841065-55841087 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1158452199 18:57576858-57576880 CTGTCTGGAGGGAGAGGAGATGG - Intronic
1159005755 18:63008897-63008919 CTGTGTGTAGGGAGAAGAGAGGG - Intergenic
1159151286 18:64526963-64526985 AAGTGTGTTGGGAGTGGGGCAGG - Intergenic
1159289282 18:66395812-66395834 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1159322183 18:66866690-66866712 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1159670246 18:71212848-71212870 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1159890771 18:73951192-73951214 CCCTGTGGAGAGAGAGGAGCGGG + Intergenic
1160085428 18:75772907-75772929 CAGGGTGTAGGGAGAGGAGGTGG - Intergenic
1160200101 18:76788903-76788925 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
1160218844 18:76957653-76957675 GAGGGAGGAGGGAGAGGAGCAGG - Intronic
1160504838 18:79421244-79421266 CTGTGCAGAGGGAGAGGAGCTGG - Intronic
1160974663 19:1786949-1786971 CAGTGGGCAGGGAGAGGTACTGG + Intronic
1160976563 19:1795770-1795792 GTGTGTGTAGGGACAGGAGGAGG - Intronic
1161313980 19:3609316-3609338 CAGTCTGGAGGGAGCAGAGCTGG - Intergenic
1161650833 19:5483693-5483715 CAGTGTTTAGGGAGGTGAGGCGG + Intergenic
1161768153 19:6217933-6217955 AGGTGTGTATGGAGAGCAGCTGG - Exonic
1162011227 19:7816420-7816442 GAGTGAGGAGGGAGAGGATCAGG + Intergenic
1162091130 19:8280723-8280745 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1162093364 19:8295561-8295583 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1162095200 19:8306122-8306144 CAGGGTGTAGGGAGGAGAGAGGG - Intronic
1162115853 19:8428986-8429008 CAGAGTGTAGGGAGAAAAGTGGG + Intronic
1162174428 19:8820914-8820936 CAGTGGGTAGGGAAAGTAACGGG + Intronic
1162772057 19:12955088-12955110 GAGGGTGGAGGGAGAGGATCAGG - Intronic
1163263214 19:16203796-16203818 ATGGGTGTGGGGAGAGGAGCAGG + Intronic
1163838023 19:19587925-19587947 CTGGGTGAAGGGAGAGGAGGGGG + Intronic
1165036350 19:33036629-33036651 AAGTGTGGAGGGAGAGGCGCGGG + Intronic
1165415571 19:35691430-35691452 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1165846547 19:38821487-38821509 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1165933597 19:39375822-39375844 CAGTGAGCAGACAGAGGAGCAGG + Exonic
1166345589 19:42163298-42163320 GAGTGTGTGGGCAGAGGAGGAGG + Intronic
1166732519 19:45067188-45067210 CATTTTGGAGGGAGAGTAGCAGG + Intronic
1166933820 19:46318963-46318985 CACTGTGTAAGTAGCGGAGCTGG + Intronic
1167081137 19:47276647-47276669 CAGTTTGTAATGAGAGGAGCTGG - Intergenic
1168059302 19:53882423-53882445 CAGGTGGAAGGGAGAGGAGCTGG - Exonic
1168145275 19:54416742-54416764 CCGTGTGTGGGGAGAGGGGGCGG - Intronic
1168646815 19:58064419-58064441 CAGTGAGTAGGCTGAGGAGTAGG - Intronic
924967340 2:90982-91004 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
924977515 2:191713-191735 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
925172644 2:1759681-1759703 GGGTGTGGAGGGAGAGGCGCAGG - Intergenic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
926335795 2:11861741-11861763 CAGTGTGCAGGGAGAGGCTGTGG + Intergenic
926474809 2:13308661-13308683 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
926615999 2:14997151-14997173 GAGGATGGAGGGAGAGGAGCAGG + Intergenic
926689858 2:15725712-15725734 CAGGCTGCTGGGAGAGGAGCAGG + Intronic
926850630 2:17193544-17193566 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
927137392 2:20106898-20106920 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
927571887 2:24167211-24167233 CAGCGTGGGTGGAGAGGAGCTGG + Intronic
927777766 2:25915491-25915513 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
927783090 2:25954890-25954912 CAGTGGCTTTGGAGAGGAGCAGG - Intronic
927900391 2:26814461-26814483 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
928880542 2:36092231-36092253 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
929109836 2:38397301-38397323 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
929466188 2:42146474-42146496 CAGTGGGTAGATAGATGAGCTGG - Intergenic
929694071 2:44099274-44099296 AAGAGTATAGGAAGAGGAGCAGG - Intergenic
929768251 2:44868895-44868917 CAGTGTGTCAGGAGAGGACTGGG + Intergenic
931106934 2:59066918-59066940 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
932083050 2:68732662-68732684 CAGTGGGGAGGGAGAAGGGCCGG - Intronic
932178242 2:69622073-69622095 AGGTGTGGAGGGAGAGGTGCGGG + Intronic
932451704 2:71814684-71814706 CAGTGTGGTGTGAGAGGTGCTGG - Intergenic
932770187 2:74496846-74496868 CAGTGTGAGGGGAGAGGAGGGGG - Intergenic
933415784 2:81985165-81985187 AAGTGTGGAGGGAAAGGCGCAGG + Intergenic
933511505 2:83246296-83246318 AGGTGTGGAGGGAGAGGGGCAGG - Intergenic
933712184 2:85334721-85334743 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
933727519 2:85435142-85435164 CAGGCTGTAGGGAGAGGTTCCGG + Intronic
934064742 2:88330461-88330483 TTGACTGTAGGGAGAGGAGCAGG + Intergenic
934085087 2:88503128-88503150 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
934177843 2:89592879-89592901 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
934288141 2:91667180-91667202 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
935790271 2:106584409-106584431 AGGTGTGAAGGGAGAGGCGCCGG + Intergenic
936172739 2:110190563-110190585 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
937025351 2:118692966-118692988 CAGCCTGCAGGGAGAGGAGCGGG + Intergenic
937181098 2:119996973-119996995 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
937660062 2:124420450-124420472 CAGTGTGAAGGGAGGTAAGCAGG - Intronic
937716277 2:125037325-125037347 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
938177217 2:129144610-129144632 AGGTGTGGAGGGAGAGGTGCCGG - Intergenic
938512579 2:131966428-131966450 AAGTGTGAAGAGAGAGGCGCGGG + Intergenic
938728739 2:134129932-134129954 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
938931239 2:136088393-136088415 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
939165967 2:138641736-138641758 CATTGAGCAGGGAGAGGAGGTGG - Intergenic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939275250 2:139991069-139991091 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
939969641 2:148644885-148644907 CAGTGAGGAGGAGGAGGAGCGGG + Intronic
940321811 2:152385326-152385348 CAGTTTGTAGGGAGGGAGGCTGG + Intronic
940453794 2:153872106-153872128 AAGTGTGAAGAGAGAGGCGCGGG + Exonic
940485607 2:154291668-154291690 AGGTGTGGAGGGAGAGGTGCGGG - Intronic
940609829 2:155976188-155976210 CAGAGTGTAGGAAGAGAAGGAGG + Intergenic
941035745 2:160567567-160567589 CACAGTGTAGGGTGAAGAGCAGG - Intergenic
941068390 2:160928788-160928810 AGGTGTGTAGGGAGAGGAAAAGG + Intergenic
941274838 2:163478277-163478299 CAGGGAGGAGGGAGAGGATCAGG - Intergenic
941476631 2:165957438-165957460 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
942214877 2:173708922-173708944 CCGAGTGTAGGGATATGAGCAGG - Intergenic
942368704 2:175257373-175257395 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
943106195 2:183547016-183547038 ATGTGTGGAGGGAGAGGTGCAGG - Intergenic
943790013 2:191921647-191921669 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
943791936 2:191942942-191942964 GAGTTTGCAGGCAGAGGAGCTGG - Intergenic
943942684 2:194020151-194020173 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
944058523 2:195547682-195547704 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
944482764 2:200174774-200174796 ACGTGTGGAGGGAGAGGCGCGGG + Intergenic
944688244 2:202136710-202136732 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
944971876 2:205002637-205002659 CAGGGTGGAGGCAGAAGAGCAGG - Intronic
945069609 2:205977220-205977242 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
945302601 2:208228054-208228076 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
945431330 2:209769654-209769676 CTGGGAGTAGGGAGAGGATCAGG - Intergenic
945664260 2:212721433-212721455 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
946053955 2:216885239-216885261 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
946376467 2:219312810-219312832 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
946411356 2:219516828-219516850 CATTGTGCAGGGAGAAGAGTCGG + Intronic
946889897 2:224264443-224264465 GTGTGTTTGGGGAGAGGAGCTGG + Intergenic
946929106 2:224655288-224655310 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
947175557 2:227363484-227363506 CTGTGTGTAGAGAAAGGAGAAGG - Exonic
947685463 2:232080257-232080279 GAGTGTGCTGGGTGAGGAGCAGG + Intronic
948061503 2:235045914-235045936 CAGTGTGCAGGGAGATGGGAAGG + Intronic
948596717 2:239084069-239084091 CAGCGTGTGGACAGAGGAGCTGG - Intronic
948664367 2:239525911-239525933 CTGAGAGGAGGGAGAGGAGCAGG - Intergenic
948820057 2:240538271-240538293 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
1168750289 20:277192-277214 CAGTCTGGTGGGAGAGGGGCAGG + Intronic
1169617262 20:7462599-7462621 ACGTGGGTAGGGGGAGGAGCTGG - Intergenic
1169630269 20:7622816-7622838 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1169636931 20:7702774-7702796 CAATGAGGAGGGAGAGCAGCAGG - Intergenic
1170230906 20:14045153-14045175 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1170411445 20:16096417-16096439 CAGTGTGCAGGGACTGGGGCAGG + Intergenic
1171303445 20:24084276-24084298 CACTGGGTAGGGAAAGCAGCTGG - Intergenic
1171360228 20:24582137-24582159 CAGTGGGGAGGGAGTGCAGCAGG - Intronic
1172178682 20:32987589-32987611 CAGGGTTTGGGGACAGGAGCTGG - Intronic
1172318169 20:33972892-33972914 TAGTTTTTAGGGAGAGGACCTGG + Intergenic
1172580186 20:36041351-36041373 CTGTTTGGAGGGAGGGGAGCAGG - Intergenic
1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG + Intronic
1172616420 20:36288694-36288716 CATTGTGTAGGCAGAGGAAGAGG + Intergenic
1172656645 20:36542031-36542053 CAGGGTGTAGGGATGGGAGATGG - Intronic
1172971384 20:38875445-38875467 CAGCATGCAGGGAGAGTAGCAGG + Intronic
1173534566 20:43799759-43799781 CACTGTGCAGGGAGTGGTGCCGG - Intergenic
1173928461 20:46798553-46798575 CAGCGATTAGGGAGAGGAGGTGG - Intergenic
1174061588 20:47836750-47836772 CAGTGAGATAGGAGAGGAGCAGG + Intergenic
1174092241 20:48058764-48058786 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1174162921 20:48564433-48564455 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1174263492 20:49314525-49314547 TTGTCTTTAGGGAGAGGAGCTGG - Intergenic
1174514885 20:51083956-51083978 CAGGGTGGAGGCAGAGGAGGAGG + Intergenic
1175320530 20:58084703-58084725 CTGTGTGGAGGGAGGGGATCTGG - Intergenic
1175339934 20:58222230-58222252 GAGTGTGGAGGAGGAGGAGCGGG + Intronic
1175593402 20:60211809-60211831 CACTGTGTTGGGAGAGCAGTGGG + Intergenic
1176061220 20:63173781-63173803 CAGTGTGGAGCGAGGGGAGCTGG - Intergenic
1176141016 20:63545128-63545150 CCGGGTGTCGGGAGAGGGGCCGG + Intronic
1176179971 20:63745194-63745216 CGGAGTGTGGGGATAGGAGCCGG - Exonic
1176304920 21:5118303-5118325 AGGTGTGGAGGGAGAGCAGCCGG - Intronic
1176663186 21:9660025-9660047 AGGTGTGGAGGGAGAGGTGCAGG + Intergenic
1176671005 21:9735528-9735550 AAGTGTGGAGGGAGAGGCACGGG + Intergenic
1176781183 21:13196367-13196389 AAGTGTGAAGAGAGAGGCGCGGG - Intergenic
1177549060 21:22597791-22597813 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1177716002 21:24840453-24840475 AGGTGTGTGGGGAGAGGCGCGGG - Intergenic
1177795866 21:25778357-25778379 AAGCGTGGAGGGAGAGGCGCGGG + Intergenic
1178074141 21:29000166-29000188 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1178082250 21:29077488-29077510 AGGTGTGGAGGGAGAGGTGCGGG - Intronic
1178244702 21:30939124-30939146 TAAAGTGTGGGGAGAGGAGCAGG + Intergenic
1178260848 21:31098525-31098547 CAGTGTTTAGGAATAGGAGAGGG - Intergenic
1178378856 21:32091901-32091923 CAGTTTGGAAGGAGAGGAGAGGG - Intergenic
1178930923 21:36818438-36818460 CAGTGTGTAGGGACAAAAGCGGG - Intronic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1179852134 21:44143727-44143749 AGGTGTGGAGGGAGAGCAGCCGG + Intronic
1180966444 22:19790444-19790466 CAGTGAGGTGGGAGAGGAGAAGG - Intronic
1181077701 22:20392727-20392749 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1181519280 22:23436148-23436170 CAGCGTGCAGGGAGAGCAGAGGG + Intergenic
1181800919 22:25347277-25347299 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1182023801 22:27101701-27101723 CAGTGTGATGGGAGAGGAGATGG + Intergenic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182929977 22:34164078-34164100 CAGTGTGTAGGAAGCTGAACTGG + Intergenic
1183465161 22:37976397-37976419 CATAGTCTAGAGAGAGGAGCAGG - Intronic
1183650779 22:39152301-39152323 CAGCGTGGAGGGAGCGGTGCTGG + Intronic
1183968785 22:41460239-41460261 CTGGGTGAAGGGAGAGGAGGGGG + Exonic
1184189995 22:42888058-42888080 GCTTGTGTAGGGAGAGGGGCTGG - Intronic
1184378359 22:44129413-44129435 CAGGGTGGAGGAAGAGGAGTCGG - Intronic
1184457743 22:44621100-44621122 CAGTGTGCAGGCAGAGGCACTGG + Intergenic
1184507783 22:44914547-44914569 CAGTCAGGAGGCAGAGGAGCTGG + Intronic
1184515317 22:44958265-44958287 CACTGTGTAGGGAGAGAGTCAGG - Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184763723 22:46560927-46560949 TTGTGTGCAGGGAGAGGAGCTGG + Intergenic
1184989278 22:48156220-48156242 CAGTGGGTAGGGAGAGAGGGAGG - Intergenic
1185032081 22:48449504-48449526 CAGTGTGTGGGCAGAGCACCTGG - Intergenic
1185125419 22:49008043-49008065 CAGAGTGCAGTGAGAGGAGAGGG - Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185347743 22:50317785-50317807 CTGTGTGGCAGGAGAGGAGCTGG - Intronic
1185390574 22:50559106-50559128 GAGTGTGTAGTGAGAAGAGAAGG - Intronic
1185391046 22:50562086-50562108 GAGTGTGCAGTGAGGGGAGCGGG + Intronic
950068978 3:10136736-10136758 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
950470131 3:13179745-13179767 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
950529251 3:13543618-13543640 GAGTGTCTGGGGAGAGGAGTGGG - Intergenic
950601191 3:14037188-14037210 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
950632600 3:14293197-14293219 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
950683329 3:14600515-14600537 CAACGTGTAGGCAGATGAGCTGG + Intergenic
951415401 3:22416942-22416964 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
951551915 3:23882905-23882927 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
951734761 3:25851755-25851777 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
952076277 3:29701567-29701589 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
952331489 3:32367830-32367852 GAGTGTTTAGGGAGAGGGGAGGG - Intronic
952453656 3:33453439-33453461 AAGTGTGGAGGGAGAGGCGCAGG + Intergenic
952520851 3:34155878-34155900 CAATGGGTAGGGAGAGCAGCGGG - Intergenic
952954580 3:38549188-38549210 CTCTGTGTCTGGAGAGGAGCTGG + Exonic
953126437 3:40095487-40095509 GAGTGTGAAGGCAGAGGATCAGG - Intronic
953418269 3:42735266-42735288 CAGAGTGTAGGGAAAGGGGAGGG + Intronic
953497861 3:43403878-43403900 CATTGTGTAGTGGGGGGAGCAGG - Intronic
954089368 3:48272293-48272315 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
956195704 3:66651561-66651583 GGGTGTGGAGGGAGAGGCGCGGG + Intergenic
957209468 3:77240454-77240476 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
957446101 3:80314493-80314515 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
957797430 3:85029736-85029758 GAGTTTGTAGAGAGATGAGCAGG - Intronic
957919899 3:86733448-86733470 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
958151014 3:89695536-89695558 CTGTGTGTAGGGAGAGGGGCAGG - Intergenic
958720706 3:97839461-97839483 CATTAAGTAGGGAGTGGAGCTGG - Intronic
958810788 3:98858294-98858316 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
959254088 3:103989061-103989083 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
959378803 3:105617342-105617364 CAGAGTGTAGGGGGAGGAGAAGG - Intergenic
959538308 3:107512257-107512279 AAGTGTGAATGGAGAAGAGCTGG - Intergenic
960199443 3:114813024-114813046 AGGTGTGGAGGGAGAGGTGCGGG - Intronic
960268377 3:115647564-115647586 CAGTATGAAGGGAGAGTAGAAGG + Intronic
960284505 3:115811922-115811944 CAGCTTGTAAGCAGAGGAGCTGG + Intronic
961061383 3:123831946-123831968 CAGGGTCTAGGGAGAGGCCCTGG + Intronic
961461995 3:127056476-127056498 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
961604454 3:128083389-128083411 CAGTGTAGAGGCACAGGAGCTGG + Intronic
962177285 3:133167762-133167784 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
962454183 3:135549892-135549914 CAGTAGGGAGGGGGAGGAGCTGG + Intergenic
962998097 3:140651414-140651436 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
963057109 3:141194633-141194655 CAGTGAGGAGGAAGAGGATCAGG - Intergenic
963289449 3:143473130-143473152 CAGTGGGAAATGAGAGGAGCTGG - Intronic
963397845 3:144756876-144756898 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
963651863 3:147989750-147989772 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
963760554 3:149284011-149284033 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
964064026 3:152559426-152559448 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
964138394 3:153370129-153370151 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
964375015 3:156041309-156041331 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
964376225 3:156051768-156051790 AGGTGTGGAGGGAGAGGCGCTGG + Intronic
964378491 3:156073151-156073173 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
964880521 3:161418103-161418125 CAGTGATGAGGCAGAGGAGCTGG + Intergenic
964974129 3:162599688-162599710 GAGTGTGGAGGGAGAGGCGCAGG + Intergenic
965003484 3:162987341-162987363 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
965092210 3:164179243-164179265 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
965139220 3:164814242-164814264 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
965220519 3:165921092-165921114 CTGAGTGTTGGGAGAGAAGCTGG + Intergenic
965385037 3:168035646-168035668 GAAGGTGGAGGGAGAGGAGCAGG + Intronic
965744248 3:171907420-171907442 AGGTGTGGAGGGAGAGGCGCCGG - Intronic
965943527 3:174212342-174212364 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
966425497 3:179775859-179775881 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
966548996 3:181183357-181183379 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
967037564 3:185659275-185659297 GAATGTGGAGAGAGAGGAGCAGG + Intronic
967718305 3:192789022-192789044 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
967869053 3:194214540-194214562 CAGTGCATAGGGAGGGCAGCTGG + Intergenic
968513076 4:1003756-1003778 CAGTGTGTGGGGTGAAGGGCAGG - Intronic
969303195 4:6309394-6309416 AGGTGTGCAGGGAGAGGCGCGGG - Intergenic
969376727 4:6768130-6768152 CAGGGTGGGGGGAGGGGAGCTGG - Intergenic
969829067 4:9781065-9781087 CAGGGTGTTGAGAGAGGGGCTGG + Intronic
970182560 4:13415389-13415411 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
970479964 4:16462899-16462921 CAGTCTGTAGGGTGAGAGGCAGG - Intergenic
970553382 4:17206898-17206920 GAGTGTGGAGGAAGAGGAGCAGG - Intergenic
971564231 4:28117511-28117533 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
971759459 4:30746401-30746423 CAGCGTGAAGGGAGAGCAGGGGG + Intronic
971792391 4:31185340-31185362 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
971798547 4:31259301-31259323 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
972344603 4:38182569-38182591 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
973764349 4:54149669-54149691 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
974186757 4:58456922-58456944 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
974274886 4:59705844-59705866 CACTGTGTTGGGAGAGTAGGAGG + Intergenic
974398914 4:61375560-61375582 CAGTGTGAAAGGAAAGGAGATGG + Intronic
974540733 4:63230911-63230933 CATTGAGTAGGGAGAGGATGGGG + Intergenic
975033927 4:69658293-69658315 AGGTGTGGAGGGAGAGGAGCAGG - Intergenic
975060093 4:69986189-69986211 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
975160665 4:71120918-71120940 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
975298778 4:72765889-72765911 AAATGTGGAGGGAGAGGCGCGGG + Intergenic
975898392 4:79121923-79121945 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
975994903 4:80302828-80302850 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
976408892 4:84690445-84690467 CAGGGTGTAGGCACAGGAGATGG + Intronic
976565501 4:86547310-86547332 AGGTGTGGAGGGAGAGGCGCTGG + Intronic
976690643 4:87864035-87864057 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
976846036 4:89490047-89490069 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
977176784 4:93828675-93828697 GAGGGGGTTGGGAGAGGAGCGGG + Intergenic
977401273 4:96535246-96535268 GGGTGTGGAGGGAGAGGATCAGG + Intergenic
978030556 4:103936768-103936790 AAGTGTGGAGGGAGATGCGCAGG + Intergenic
978228322 4:106366011-106366033 CTGTGAATAAGGAGAGGAGCTGG - Intergenic
978463652 4:108984722-108984744 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
978466217 4:109012464-109012486 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
978886511 4:113772326-113772348 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
978944773 4:114482051-114482073 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
979033254 4:115678812-115678834 AAGTGTGGAGGCAGAGGCGCGGG - Intergenic
979920423 4:126490010-126490032 AGGTGTGGAGGGAGAGGTGCAGG + Intergenic
979949546 4:126874808-126874830 AGGTGTGGAGGGAGAGGTGCCGG - Intergenic
980115182 4:128672653-128672675 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
980739230 4:136929005-136929027 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
981115105 4:140980554-140980576 CCATGTGTAGTGGGAGGAGCTGG + Intronic
981862252 4:149370823-149370845 TAGTGTGTAGGTGGAGGAGTAGG - Intergenic
982468894 4:155762227-155762249 CAGAGGGTAGGGAGGGGAGGAGG - Intronic
982692744 4:158566934-158566956 AGGTGTGGAGGGAGAGGGGCAGG + Intronic
982863346 4:160481760-160481782 AAGTGTGGAGGGAGCGGCGCGGG + Intergenic
983656700 4:170091221-170091243 AGGTGTGTAGGGAGAGGCACGGG + Intronic
983734675 4:171043160-171043182 AAGTGTGGAGGGAGAGGCGCGGG + Intergenic
983843220 4:172482242-172482264 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
984005208 4:174297847-174297869 ATGTGTGTAGGGATAGGAGGCGG + Intronic
984069255 4:175092102-175092124 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
984636087 4:182111292-182111314 CAGAGTGTATGAAGAGAAGCTGG - Intergenic
984689827 4:182714158-182714180 CAGCCTGGATGGAGAGGAGCAGG + Exonic
984762693 4:183376656-183376678 CAGTGGGGAGGGGGAGGAGCGGG - Intergenic
984901711 4:184591899-184591921 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
985354744 4:189106453-189106475 CAGAGTGTCGGGAGAGGATAAGG - Intergenic
985403637 4:189615587-189615609 AAGTGTGGAGGGAGAGGCGCAGG - Intergenic
985423579 4:189807257-189807279 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
985999928 5:3622391-3622413 CAGTGCCTAGGAAGAGGGGCTGG + Intergenic
986912572 5:12574844-12574866 CGGTGTGGAGGGAGAGGCGCAGG - Intergenic
986918989 5:12661897-12661919 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
986993242 5:13578502-13578524 AGGTGTGAAGGGAGAGGCGCTGG + Intergenic
987352318 5:17032762-17032784 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
987395672 5:17420874-17420896 CAGTGTGCAGGGACTGGAGAGGG - Intergenic
987425422 5:17767373-17767395 CACTCTGGATGGAGAGGAGCTGG + Intergenic
987696563 5:21341386-21341408 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
987923664 5:24314301-24314323 AAGTGTGAAGAGAGAGGCGCGGG + Intergenic
988020558 5:25614925-25614947 AGGTGTGGAGGGAGAAGAGCAGG - Intergenic
988177222 5:27743452-27743474 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
988291790 5:29296807-29296829 AGGTGTGTAGGGAGAGGCACAGG - Intergenic
988605228 5:32673460-32673482 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
988755640 5:34245184-34245206 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
989207120 5:38821888-38821910 AGGTGTGGAGGGAGAGGTGCCGG + Intergenic
990387163 5:55276977-55276999 CAGTGAGTCAGCAGAGGAGCTGG - Intronic
990665749 5:58069480-58069502 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
990869438 5:60415446-60415468 AGGTGTGGAGGGAGAGGTGCAGG + Intronic
990880189 5:60530310-60530332 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
990994008 5:61712982-61713004 CAGTGGCTAGGGAGAGAGGCTGG + Intronic
991304204 5:65159438-65159460 CGGTGGGTTGGGAGATGAGCAGG - Intronic
991330262 5:65485801-65485823 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
991743891 5:69710955-69710977 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
991753818 5:69844287-69844309 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
991795463 5:70290687-70290709 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
991803435 5:70401014-70401036 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
991823261 5:70586223-70586245 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
991833134 5:70719400-70719422 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
991887830 5:71290206-71290228 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
991994442 5:72373630-72373652 CATTGCGGAGGGGGAGGAGCTGG - Intergenic
992140195 5:73788650-73788672 CATTGAGTAGGCTGAGGAGCAGG + Intronic
993068895 5:83133940-83133962 CAGTGTGAAGAGAGAGGCGCTGG + Intronic
993770243 5:91917268-91917290 AGGTGTGGAGGGAGAGGTGCTGG + Intergenic
994411371 5:99410650-99410672 AGGTGTGAAGGGAGAGGTGCTGG - Intergenic
994482456 5:100354597-100354619 AGGTGTGAAGGGAGAGGTGCTGG + Intergenic
995206690 5:109488172-109488194 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
995326440 5:110894356-110894378 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
995707367 5:114999327-114999349 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
996298594 5:121954321-121954343 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
996404730 5:123094099-123094121 AAGGGTTTAGGGAGAGGGGCTGG + Intronic
996483383 5:124001225-124001247 CAGAGGGTCGGGAGGGGAGCTGG + Intergenic
996530358 5:124521614-124521636 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
996747138 5:126854899-126854921 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
996815536 5:127569446-127569468 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998691728 5:144595124-144595146 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
998812339 5:145978880-145978902 CTGTGTGTGGGGAGAGGCCCTGG + Intronic
999327760 5:150653666-150653688 CACAGTTTAGGGAGAGGAGCTGG - Exonic
999502781 5:152163514-152163536 CAGTTTGTAGGTAGCAGAGCCGG - Intergenic
1000084714 5:157879301-157879323 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1000085831 5:157886847-157886869 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1000212328 5:159119164-159119186 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1000380114 5:160621344-160621366 CAGTGTGTAGGGAGTAGAGTTGG + Intronic
1001254703 5:170174678-170174700 GGGTGTGTAGGGAGAGGATATGG - Intergenic
1001318906 5:170664131-170664153 CAGAGTGTAGGGGGAGTTGCAGG - Intronic
1001748769 5:174111940-174111962 CAGTGAGGAGAGAGAGGAGCGGG - Intronic
1001957079 5:175855128-175855150 CAGTCGGCAGGGAGAGCAGCTGG + Intronic
1002119908 5:176994969-176994991 CAGTGTGCTGGGAGAGTATCTGG + Intronic
1002616407 5:180459163-180459185 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1002817671 6:694618-694640 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
1003178449 6:3771629-3771651 AAGTGTGGAGGGAGAGGCACGGG + Intergenic
1003213709 6:4090133-4090155 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1003284888 6:4725675-4725697 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1003578329 6:7317103-7317125 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1003593679 6:7456353-7456375 AAGTGTGGAGGGAGAGGCGCGGG + Intergenic
1003824875 6:9942166-9942188 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1003882561 6:10491631-10491653 GAGTGTGGAGGGAGAGCCGCGGG + Intergenic
1003956639 6:11171065-11171087 AGGTGTGGAGGGAGAGGGGCGGG + Intergenic
1003984011 6:11417364-11417386 AAGTGTGGAGGGAGAGGCGCGGG - Intergenic
1004201860 6:13555930-13555952 CAGAGTGGGGGGAGAGGAGCTGG + Intergenic
1004250275 6:14018026-14018048 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1004378037 6:15107637-15107659 AAGTGTGTGGTGAGAGGGGCTGG - Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004999744 6:21229027-21229049 CAGAGTGCAGGGAGACCAGCAGG + Intronic
1005059248 6:21761150-21761172 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1005486159 6:26301897-26301919 CAGTGGCTGGGGAGAGAAGCAGG - Intergenic
1005554278 6:26956959-26956981 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1005561407 6:27045277-27045299 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1005712561 6:28515858-28515880 GTGTGTGTAGGGAGTGGAGGTGG - Intronic
1005955331 6:30659630-30659652 TAGAGGGTAGGGAGAGCAGCAGG + Intronic
1006127929 6:31852048-31852070 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1006129306 6:31859811-31859833 CAGCATGGATGGAGAGGAGCAGG - Exonic
1006351136 6:33521855-33521877 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1007691246 6:43702922-43702944 CAGAGGGTGGGGAGAGGAGGAGG + Intergenic
1007738697 6:43998089-43998111 AAGTGTGGAGGGAGAGGGGCGGG + Intergenic
1007843010 6:44731981-44732003 CTGTGTGTAGAGAGTGGTGCAGG + Intergenic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1009402720 6:63275299-63275321 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1009541171 6:64960780-64960802 TAGGGAGTAGGGAGAGGATCAGG - Intronic
1009746651 6:67825393-67825415 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1010066259 6:71686151-71686173 AGGTGTGGAGGGAGAGGTGCAGG + Intergenic
1010252614 6:73723752-73723774 GAGGGAGGAGGGAGAGGAGCAGG + Intronic
1010269309 6:73903150-73903172 AAGTGTGGAGGGAGAGGCACGGG + Intergenic
1010277983 6:73990999-73991021 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1010431566 6:75784034-75784056 CAGGTTGTAGGGAGCGGAGATGG - Intronic
1011178094 6:84587423-84587445 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1011338384 6:86285145-86285167 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1011555473 6:88567976-88567998 CAGGGGCTAGGGAGAGGAGTGGG - Intergenic
1011848832 6:91600933-91600955 CCATCTGTAGGGAGAGGAGTGGG + Intergenic
1011974731 6:93282638-93282660 AGGTGTGGAGGGAGAGGGGCAGG + Intronic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1012429770 6:99152266-99152288 AAATGTGTAGGGAGTGCAGCTGG + Intergenic
1012541118 6:100363046-100363068 GTGTGTGTGGGGAGAGGGGCAGG - Intergenic
1012598823 6:101070254-101070276 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1012850959 6:104446327-104446349 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1013035821 6:106381687-106381709 CCGTCTTTGGGGAGAGGAGCTGG + Intergenic
1013397785 6:109759995-109760017 CAGGGTGCAGGGAGAGTACCAGG + Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013542760 6:111127418-111127440 CAGTGTGGAGGTAGAGGGACTGG + Intronic
1013601570 6:111710101-111710123 GAGGGTGGAGGGGGAGGAGCTGG - Intronic
1013627948 6:111956312-111956334 CAGAGAGTGGGGAGAGGAGATGG + Intergenic
1013694855 6:112689760-112689782 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1014738957 6:125125844-125125866 AGGTGTGGAGGGAGAGGTGCAGG + Intronic
1015168114 6:130221680-130221702 CAGTGAGTAGGCTGAGGAGGAGG + Intronic
1016081501 6:139862632-139862654 CTTAGTGTAGGGAGAGGGGCAGG - Intergenic
1016104765 6:140148489-140148511 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1016174661 6:141065790-141065812 CAGTGTGTTGGAAGAAGAGTAGG + Intergenic
1016183490 6:141175085-141175107 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1016221602 6:141677922-141677944 AAATGTGGAGGGAGAGGAGACGG - Intergenic
1016859097 6:148698950-148698972 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1017444135 6:154492204-154492226 CAGTATGTAGGAAGAGGAATAGG - Intronic
1018066614 6:160129026-160129048 CAGTGTGGAGGGACGGGGGCAGG + Intronic
1018848796 6:167573104-167573126 CTCTGTGTAGGGAGAGGAACGGG - Intergenic
1019420387 7:948060-948082 CAAGGTGTGGGGTGAGGAGCAGG - Intronic
1019592000 7:1840183-1840205 CAGCGTGCAGGGAGAGCAGAGGG - Intronic
1019618388 7:1977487-1977509 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1020011552 7:4808236-4808258 CAGAGAGGAGGGTGAGGAGCGGG - Intronic
1020784480 7:12556527-12556549 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
1021065796 7:16170941-16170963 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1021133839 7:16942980-16943002 AGGTGTGGAGGGAGAGGAGCTGG + Intergenic
1021468346 7:20971338-20971360 CAGTGTGTTGGGAGACCAGATGG + Intergenic
1021926078 7:25534930-25534952 CGGTGGCTGGGGAGAGGAGCAGG + Intergenic
1022174178 7:27857381-27857403 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1022519069 7:30994371-30994393 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1023049173 7:36236282-36236304 AAGTGTGAAGAGAGAGGCGCGGG + Intronic
1023181771 7:37492082-37492104 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1024397885 7:48889932-48889954 CCTTGTGCAGGGGGAGGAGCTGG + Intergenic
1024465862 7:49711245-49711267 AGGTGTGGAGGGAGAGGTGCTGG + Intergenic
1024735860 7:52303286-52303308 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
1025093999 7:56083842-56083864 CACAGTCTGGGGAGAGGAGCCGG + Intronic
1026516527 7:71077981-71078003 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1026522481 7:71129658-71129680 GTGTCTCTAGGGAGAGGAGCTGG + Intergenic
1027171841 7:75878366-75878388 CATTGTGAAGGGTGAGGGGCTGG + Intronic
1027668712 7:81071100-81071122 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1027674431 7:81141738-81141760 AGGTGTGAAGGGAGAGGAGCGGG + Intergenic
1027778925 7:82499604-82499626 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1028058776 7:86282523-86282545 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1028303329 7:89229097-89229119 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1028558070 7:92143694-92143716 ATGTGTGCAGGGAGAGGCGCGGG - Intronic
1028727140 7:94100884-94100906 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1029407051 7:100381719-100381741 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1030063540 7:105641725-105641747 CAGTGCTTAGGGAGAGCACCAGG + Intronic
1030102157 7:105956126-105956148 AAGTGTGGAGGGAGAGACGCCGG - Intronic
1030241618 7:107332333-107332355 CAGAGTGGAGAGAGAGGAGTGGG + Intronic
1030292656 7:107887978-107888000 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1030367054 7:108657585-108657607 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1030772256 7:113488495-113488517 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1031056570 7:116998367-116998389 AGGTGTGGAGGGAGAGGTGCAGG - Intronic
1031109932 7:117596139-117596161 AGGTGTGGAGGGAGAGGCGCTGG + Intronic
1031253172 7:119413697-119413719 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1031513352 7:122674199-122674221 AGGTGTGAAGGGAGAGGTGCGGG - Intronic
1031605559 7:123763540-123763562 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1031902830 7:127429157-127429179 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
1032437077 7:131909318-131909340 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1032544593 7:132731107-132731129 GCTTGAGTAGGGAGAGGAGCAGG + Intergenic
1032590895 7:133191531-133191553 CAGTGTGTGGGGACATGAGCAGG - Intergenic
1032611847 7:133423738-133423760 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1032959557 7:137015684-137015706 CTGTGTTCAGGGAGAGGAGAAGG + Exonic
1033065046 7:138146155-138146177 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1033088932 7:138367456-138367478 CGGTGTGTAGGGAAGGGAGGGGG - Intergenic
1033279736 7:139997173-139997195 GAGTGTGTGGGGTGAGGGGCAGG - Intronic
1033508664 7:142031869-142031891 CAGAGCATAGGGAGAGGAGGAGG + Intronic
1033531297 7:142266546-142266568 AGGTGAGTAGGGAGAGGAGAGGG + Intergenic
1033731712 7:144187196-144187218 CAGTGGGAAGAGCGAGGAGCAGG - Exonic
1033742562 7:144285779-144285801 CAGTGGGAAGAGCGAGGAGCAGG - Intergenic
1033751341 7:144363835-144363857 CAGTGGGAAGAGCGAGGAGCAGG + Exonic
1034513337 7:151553709-151553731 CTGGGTGCAGGCAGAGGAGCAGG + Intergenic
1034841883 7:154405643-154405665 CAGTGTGAGGGGACTGGAGCTGG + Intronic
1034967147 7:155398518-155398540 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1035359455 7:158300771-158300793 CCGTGTGGAGGGAGGGGAGGTGG + Intronic
1035463940 7:159063500-159063522 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1035593976 8:839996-840018 CAGAGTGTGGGGAGACGTGCAGG - Intergenic
1035593983 8:840049-840071 CAGAGTGTGGGGAGACGTGCAGG - Intergenic
1035593990 8:840102-840124 CAGAGTGTGGGGAGACGTGCAGG - Intergenic
1035593997 8:840155-840177 CAGAGTGTGGGGAGACGTGCAGG - Intergenic
1035594004 8:840208-840230 CAGAGTGTGGGGAGACGTGCAGG - Intergenic
1035594011 8:840261-840283 CAGAGTGTGGGGAGACGTGCAGG - Intergenic
1035594024 8:840367-840389 CAGAGTGTAGGGAAACGTGCAGG - Intergenic
1035594038 8:840473-840495 CAGAGTGTAGGGAGACGTGCAGG - Intergenic
1035594044 8:840526-840548 CAGAGTGTGGGGAGACGTGCAGG - Intergenic
1035594051 8:840579-840601 CAGAGTGTGGGGAGACGTGCAGG - Intergenic
1035594058 8:840632-840654 CAGAGTGTAGGGAGACATGCAGG - Intergenic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1035793178 8:2326215-2326237 CACTGGGCAGGGAGAGGAGGTGG + Intergenic
1035799626 8:2395490-2395512 CACTGGGCAGGGAGAGGAGGTGG - Intergenic
1036123860 8:6045387-6045409 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1036409845 8:8489260-8489282 AAGTGTGTTGGAAAAGGAGCTGG - Intergenic
1036554689 8:9848125-9848147 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1036928690 8:12931674-12931696 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1037178349 8:15973612-15973634 CAGTGAGTAAGGGGAGGAGAGGG + Intergenic
1037291970 8:17360710-17360732 CAGTGAGTACATAGAGGAGCCGG + Intronic
1037467591 8:19175086-19175108 CTGGGTGTAGGGAGAAGAGGAGG - Intergenic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038232140 8:25711307-25711329 CACTGTGTTGGGTGAGGAGTGGG - Intergenic
1038726670 8:30088134-30088156 AAGTGTGGAGGGAGAGGCGCGGG + Intergenic
1039587578 8:38719856-38719878 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1039669945 8:39584628-39584650 CAGTGAGGAGGGCGAGGAGAAGG - Exonic
1039898842 8:41735951-41735973 GTGTGTGTAGGGAGAGGGGGTGG + Intronic
1040061289 8:43105121-43105143 CAGTGTGTAGTTAGCGGATCAGG + Intronic
1040323925 8:46331724-46331746 AAGTGTGGAGGGAGAGGCGCGGG + Intergenic
1040638786 8:49306503-49306525 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1040794138 8:51271232-51271254 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1040804306 8:51377508-51377530 AGGTGTGGAGGGAGAGGTGCAGG + Intronic
1041145843 8:54875219-54875241 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1041358566 8:57025373-57025395 TAGGGTGTAGGGAGAGGGGAGGG + Intergenic
1042169516 8:65978149-65978171 AAGTGTGGAGGGAGAGCAGCAGG - Intergenic
1042490095 8:69387394-69387416 TGGTGGGTAGGGAGAGCAGCAGG + Intergenic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1043002117 8:74771963-74771985 AGGTGTGAAGGGAGAGGCGCGGG - Intronic
1043014109 8:74916803-74916825 CAGTGTGATTGCAGAGGAGCAGG + Intergenic
1043565589 8:81544072-81544094 CAGTGTAAAGTAAGAGGAGCAGG + Intergenic
1043621074 8:82192619-82192641 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
1043640129 8:82441413-82441435 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1043726021 8:83611480-83611502 GGGTGTGAAGGGAGAGGCGCAGG - Intergenic
1044441609 8:92230780-92230802 GGGTGTGGAGGGAGAGGGGCGGG + Intergenic
1044456034 8:92393919-92393941 AGGTGTGGAGGGAGAGGTGCTGG - Intergenic
1044457116 8:92401497-92401519 AGGTGGGGAGGGAGAGGAGCAGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044963879 8:97556905-97556927 CGGTGTAGAGGGAGAGGAGTGGG + Intergenic
1045173857 8:99698964-99698986 CAGAGTGTAGGGAAAGGTACAGG + Intronic
1045306059 8:100957477-100957499 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1045678451 8:104633254-104633276 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1046416988 8:113929642-113929664 ATGTGTCTAGGGAGAGGAGAAGG + Intergenic
1046621181 8:116531078-116531100 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1046873024 8:119224686-119224708 GAGTGGGTGGGGAGAGGAGAAGG - Intronic
1047124696 8:121948027-121948049 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1047304758 8:123643679-123643701 CAGTGTCCAGGCTGAGGAGCAGG + Intergenic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1048646353 8:136425581-136425603 GAGTGTGCAGGGAGAAGAGCTGG - Intergenic
1048655450 8:136530779-136530801 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1048703055 8:137115932-137115954 AAGTGTGCAGGGAGAGGCGCTGG - Intergenic
1049157668 8:141076678-141076700 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1049273172 8:141706901-141706923 CACTGAGGAGGGAGGGGAGCAGG + Intergenic
1050294872 9:4195288-4195310 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1050600114 9:7241995-7242017 CAGTGAGTAGGCCGAGGAGGAGG - Intergenic
1050898238 9:10910940-10910962 AAGTGTGAAGAGAGAGGCGCAGG + Intergenic
1051357748 9:16255102-16255124 CAGGGAGTGGGGAGTGGAGCAGG - Intronic
1051419744 9:16877423-16877445 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1051549812 9:18315699-18315721 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1051827267 9:21234169-21234191 CAGTGTTTAGCCAGAGGAGTGGG - Intronic
1051935815 9:22441021-22441043 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1051998992 9:23253207-23253229 CAGTGGGGAGGGAGAGCATCAGG + Intergenic
1052313396 9:27092645-27092667 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1055654894 9:78442061-78442083 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1055925585 9:81507365-81507387 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1056234215 9:84575406-84575428 CAGTGTGAAGGGAGAGGTACAGG + Intergenic
1056735901 9:89209394-89209416 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1056738234 9:89227692-89227714 CACTTTGTAGGGTAAGGAGCAGG - Intergenic
1056743707 9:89282422-89282444 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1057310218 9:93938345-93938367 CAGTGAGTGGGGAGAGGGGGTGG + Intergenic
1057689567 9:97271471-97271493 AAGTGTGGAGGGAGAGGCGTGGG - Intergenic
1057726877 9:97574209-97574231 AGGTGTGGAGGGAGAGGCGCCGG + Intronic
1057905587 9:98980545-98980567 CAGGGAGTAGGGAGTGCAGCTGG + Intronic
1058151995 9:101473577-101473599 TAGTGTGTAGGTAGAGAAACTGG + Exonic
1058235724 9:102487308-102487330 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1058551062 9:106115575-106115597 TAGCGTGAAGGGAAAGGAGCAGG - Intergenic
1058585404 9:106501661-106501683 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1058634160 9:107020203-107020225 CATTGTTTAAAGAGAGGAGCTGG + Intergenic
1058727481 9:107817784-107817806 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1059047193 9:110881736-110881758 CAGTGTGGAGGAAGAGGAATTGG - Intronic
1059226175 9:112675120-112675142 GGGTGTGTCGGCAGAGGAGCAGG - Intergenic
1059240940 9:112804633-112804655 CACTGAGTAGGGAGAGGCTCAGG + Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059891484 9:118809585-118809607 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1060050853 9:120377123-120377145 CAGTCTGGAGGGAGTGGAGAAGG + Intergenic
1060091314 9:120746370-120746392 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1060155036 9:121313687-121313709 CTGTCTGGAGGCAGAGGAGCAGG + Intronic
1060305414 9:122406524-122406546 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1061461268 9:130741259-130741281 CATGGTCGAGGGAGAGGAGCAGG + Intronic
1203660974 Un_KI270753v1:42603-42625 AGGTGTGCAGGGAGAGGTGCAGG + Intergenic
1203662913 Un_KI270753v1:61740-61762 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1203672156 Un_KI270755v1:25812-25834 AGGTGTGGAGGGAGAGGTGCAGG + Intergenic
1186293149 X:8121579-8121601 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1186295676 X:8145277-8145299 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186580394 X:10811468-10811490 CAGTGTGTAAGTGGAGAAGCTGG + Intronic
1187157876 X:16738031-16738053 CAGTGTTTAGGGAGGGGAAGAGG + Intronic
1187496457 X:19799826-19799848 GAGTGTGTAGTGGGAGGGGCAGG - Intronic
1187586780 X:20671742-20671764 CTGGGAGGAGGGAGAGGAGCAGG - Intergenic
1188111969 X:26204793-26204815 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1188166993 X:26874030-26874052 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1188580034 X:31700366-31700388 CAATGTGTATGGAGAGGAGTTGG + Intronic
1189187931 X:39070193-39070215 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1189209800 X:39275607-39275629 AGGTGTGGAGGGAGAGGAGTGGG + Intergenic
1190157337 X:48004611-48004633 CAGTGTGTTGGGAGTGTAGGGGG + Intronic
1190173107 X:48127496-48127518 CAGTGTGTTGGGAGTGTAGGGGG + Intergenic
1190378170 X:49811644-49811666 CTGGTTGTAGGGAGGGGAGCAGG + Intergenic
1192022432 X:67408651-67408673 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192238001 X:69308136-69308158 GTGTGTGTTGGGGGAGGAGCAGG - Intergenic
1193312447 X:80024431-80024453 CAGTGGGTAGGGAGAGGCTTGGG - Intronic
1193709005 X:84856972-84856994 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
1194084845 X:89513732-89513754 CTGTGTGTGGGGATAGGAACAGG - Intergenic
1195460294 X:105116077-105116099 AGGTGTGAAGGGAGAGGCGCAGG - Intronic
1195909642 X:109876228-109876250 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1196241413 X:113346693-113346715 CAGTGAGTAGGAACAGGATCAGG + Intergenic
1196616106 X:117769058-117769080 AGGTGTGAAGGGAGAGGCGCTGG + Intergenic
1197007812 X:121523843-121523865 AAGTTTGGAGGGAGAGCAGCAGG + Intergenic
1197272130 X:124436420-124436442 CTCAGGGTAGGGAGAGGAGCTGG - Intronic
1197533814 X:127663340-127663362 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1197607879 X:128606595-128606617 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1197716113 X:129707109-129707131 CAGTGTGCAATGAGAGGAGAAGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197978716 X:132194085-132194107 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1198256097 X:134925658-134925680 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1198379122 X:136067696-136067718 CATGGTGCAGAGAGAGGAGCTGG + Intergenic
1198618584 X:138482863-138482885 CAGAGTAGAGGGAGAGGAGGAGG - Intergenic
1198872339 X:141188869-141188891 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1198882722 X:141298582-141298604 GAGTTTGTAGGTAGAGGAGCTGG - Intergenic
1199094879 X:143726587-143726609 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1199443721 X:147897343-147897365 AGGTGTGGAGGGAGAGGTGCTGG - Intergenic
1199467985 X:148161360-148161382 CAGTGGGTGGGAAGAGGAGGAGG - Intergenic
1199628071 X:149758559-149758581 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic