ID: 927548916

View in Genome Browser
Species Human (GRCh38)
Location 2:23979659-23979681
Sequence TAGGAGGACCACTTGAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39583
Summary {0: 1, 1: 4, 2: 160, 3: 3686, 4: 35732}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927548916_927548925 8 Left 927548916 2:23979659-23979681 CCCCGTCTCAAGTGGTCCTCCTA 0: 1
1: 4
2: 160
3: 3686
4: 35732
Right 927548925 2:23979690-23979712 TCCCAAATAGCTGGAACGATAGG 0: 1
1: 25
2: 754
3: 10896
4: 83839
927548916_927548921 -1 Left 927548916 2:23979659-23979681 CCCCGTCTCAAGTGGTCCTCCTA 0: 1
1: 4
2: 160
3: 3686
4: 35732
Right 927548921 2:23979681-23979703 ACCTCCGCCTCCCAAATAGCTGG 0: 6
1: 915
2: 20735
3: 202313
4: 490409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927548916 Original CRISPR TAGGAGGACCACTTGAGACG GGG (reversed) Intronic
Too many off-targets to display for this crispr