ID: 927551362

View in Genome Browser
Species Human (GRCh38)
Location 2:24002932-24002954
Sequence GACTTCACAGTGCCCTGAAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927551360_927551362 4 Left 927551360 2:24002905-24002927 CCTTAGTATGATTATGAAAAACG 0: 1
1: 0
2: 2
3: 15
4: 137
Right 927551362 2:24002932-24002954 GACTTCACAGTGCCCTGAATGGG 0: 1
1: 0
2: 1
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927551362 Original CRISPR GACTTCACAGTGCCCTGAAT GGG Exonic
904725253 1:32541967-32541989 GACTTTACAGTGCGTTTAATGGG + Intronic
909356285 1:74713737-74713759 GAATACACAGTGCTCTGAAATGG + Intronic
910081108 1:83342618-83342640 GACTTCTCAGGGCCTTTAATGGG + Intergenic
911245219 1:95509397-95509419 GAGTTCACACTGCCTTCAATGGG - Intergenic
912723819 1:112041900-112041922 GACTTCTCAGTAGCCTGGATAGG + Intergenic
915500881 1:156316433-156316455 GACTTCACATGGCCATGAGTTGG - Intronic
916211017 1:162360084-162360106 TCCTTCACAGTGTCCTGATTTGG + Intronic
923749681 1:236736101-236736123 GCCTTCACAGTTCCGTGATTTGG + Intronic
924545269 1:245020505-245020527 GACTTCACAGACCCCGGAAAGGG - Intronic
1064679348 10:17793928-17793950 GAATTCACAGTGGCCTGAGTGGG - Intronic
1066042900 10:31568698-31568720 GAAGTCATAGTGCCTTGAATAGG - Intergenic
1069078251 10:64061386-64061408 GATATGACAGTGACCTGAATGGG + Intergenic
1069773613 10:70914458-70914480 GACTTCACTGTGTCCTGATTGGG - Intergenic
1073575140 10:104616530-104616552 CACTTCTCAGAGCCTTGAATAGG - Intergenic
1074606399 10:114973010-114973032 AGTTTCACAGTGCACTGAATAGG + Intronic
1076874644 10:133210054-133210076 GACGTCACAAAGCCCTGCATAGG + Intronic
1077082660 11:731607-731629 GAGCTCACAATGCCCTGAAAGGG - Intergenic
1081596130 11:44460839-44460861 CTCTTCACAGTGCCCCCAATTGG + Intergenic
1083723797 11:64618084-64618106 GACCTCACAGATCCCTGACTGGG + Intronic
1085055683 11:73402253-73402275 AAGTTCACAGGGCCCAGAATGGG + Intronic
1085439521 11:76545932-76545954 GTCTTCTCAGAGGCCTGAATGGG - Exonic
1091144886 11:133270228-133270250 AACTCCACAGTGTGCTGAATGGG - Intronic
1092437438 12:8461424-8461446 GCCTTCAGAATGCCCTGAAATGG + Intronic
1104105390 12:125654129-125654151 GACCTCACAGTGACCTCAAGGGG + Exonic
1107400376 13:40063526-40063548 GACCTCACAGAGGCCTCAATTGG - Intergenic
1108367835 13:49734656-49734678 GGCTCCACAGTGACCTGAAAGGG - Intronic
1108853567 13:54765697-54765719 AACTTCACACTGGCCTGAACTGG + Intergenic
1111725339 13:92000900-92000922 GCTTTCTCAGTGGCCTGAATAGG - Intronic
1111924661 13:94449796-94449818 GGTTTCACACTGCCCTAAATAGG + Intronic
1115961347 14:38838078-38838100 CACATCTCAGTGCCCAGAATGGG - Intergenic
1117074489 14:52088724-52088746 GACTTCACTGAACACTGAATCGG - Intergenic
1118179535 14:63478645-63478667 GACCTCACAGACCCCTGAAAAGG + Intronic
1120171263 14:81248846-81248868 GACTTCATAGTACACTAAATAGG + Intergenic
1124126158 15:26939544-26939566 GATTTCACAGAGCCCTGCAGAGG - Intronic
1128353502 15:66908010-66908032 GCCTTCACAGTGCCCTGGGTTGG - Intergenic
1138334409 16:56241184-56241206 GCCCTCAAAGTGCTCTGAATTGG - Intronic
1138386531 16:56639134-56639156 GGCTTCATGGTGCCCTGAGTTGG + Intronic
1141439682 16:84021867-84021889 GACTTTGCAGAGCCCTGAAGTGG + Intronic
1141737000 16:85860564-85860586 GACTCCCCAGTTCCCTGCATGGG + Intergenic
1146937765 17:36823399-36823421 GACGGCTCAGTGCCCAGAATAGG - Intergenic
1147801378 17:43091621-43091643 TTCTTCACAGTGCAGTGAATTGG - Exonic
1148966196 17:51438071-51438093 GACTGCACGGTGGCCTGACTTGG + Intergenic
1151737288 17:75951682-75951704 TACCTCACAGTGCCCTTAAGAGG - Intronic
1152461588 17:80444857-80444879 GACTTCTCACTCCCCCGAATGGG - Intergenic
1154930396 18:20988721-20988743 GACTTGGCACTGCCCTGGATGGG - Intronic
1155463449 18:26109482-26109504 AACTCCACAGTGAACTGAATGGG - Intergenic
1156445653 18:37235087-37235109 GACTTTCTAGTGCCCTGAGTGGG - Intergenic
1163691809 19:18742481-18742503 GGCTTCCCACTGGCCTGAATCGG - Intronic
1164311983 19:24054023-24054045 GCCTGCACTGTGCCCTGAACAGG + Intronic
1165098504 19:33424112-33424134 GACTTCCCACTGCCCTCACTGGG + Intronic
1168194516 19:54764099-54764121 GATTTCACAGAGCCCTGTTTTGG - Intronic
1168709111 19:58488018-58488040 GCCCTCACAGTGCCATGAACAGG - Intronic
1168709122 19:58488074-58488096 GCCCTCACAGTGCCATGAACAGG - Intronic
1168709133 19:58488130-58488152 GCCCTCACAGTGCCATGAACAGG - Intronic
1168709143 19:58488186-58488208 GTCCTCACAGTGCCATGAACAGG - Intronic
1168709152 19:58488242-58488264 GTCCTCACAGTGCCATGAACAGG - Intronic
1168709163 19:58488298-58488320 GCCCTCACAGTGCCATGAACAGG - Intronic
925412864 2:3650132-3650154 GGCTGCACAGTGCCCTCAATTGG + Intergenic
925799119 2:7579973-7579995 GAGTCCACAGTGCCCTGGCTAGG + Intergenic
926112523 2:10192310-10192332 GACTTCTCAGAGCCTTTAATGGG + Intronic
927551362 2:24002932-24002954 GACTTCACAGTGCCCTGAATGGG + Exonic
928838227 2:35574031-35574053 GACTTCACAGTGCCTCAAACAGG + Intergenic
932075802 2:68661628-68661650 AAGTTCACAGTCCCCTGAACTGG + Intergenic
933517967 2:83330462-83330484 GACCTCACAGACCCCTGAAAGGG + Intergenic
934780145 2:96964789-96964811 GAGGTCACAGTGCCCTGCACAGG - Intronic
937994101 2:127680024-127680046 CAGTTCCCAGTGCCCTGAAAGGG - Intronic
941635398 2:167930341-167930363 GACTTCAATGTGCCCACAATGGG - Intergenic
945056181 2:205871292-205871314 GACTTCAGAGTTATCTGAATGGG - Intergenic
946095268 2:217269406-217269428 GACTCCACAGTGCTCTGCAAGGG + Intergenic
1172442550 20:34976460-34976482 GGCGTCACGGAGCCCTGAATGGG + Intronic
1172835513 20:37870608-37870630 GACGTGACAGTGGCCTGGATTGG - Intronic
1176216242 20:63949307-63949329 CACTGCACGGTGCCCTGAAGGGG + Intronic
1179032745 21:37734803-37734825 GATTTCTCAGAGCCCTTAATAGG - Intronic
1179374172 21:40834673-40834695 GACTTCAGTGTGCCCTGAGCAGG + Intronic
1181769206 22:25113251-25113273 GACTGCAAAGAGCCGTGAATGGG - Intronic
1182950658 22:34372582-34372604 GACTTCACGGTGTGCTGAGTAGG + Intergenic
1184866357 22:47203800-47203822 GTCTCCACCTTGCCCTGAATTGG + Intergenic
951437752 3:22684769-22684791 TGCTTCACACTGCCCTGCATCGG + Intergenic
961756541 3:129130477-129130499 GACTTCACAGAGCACTGTAGTGG - Intronic
963053553 3:141163494-141163516 GACTTCCCAGTGTCCAGAACTGG + Intergenic
964184133 3:153922448-153922470 GACTTAACAGAGCACTGATTCGG + Intergenic
966175520 3:177134142-177134164 GACATCACAGTGGGCTGACTTGG - Intronic
966632492 3:182094193-182094215 GGCTCCACAGTGCCCAGCATAGG - Intergenic
967485772 3:190028595-190028617 ATCTTCATAGTGCCCTGCATAGG + Intronic
971763751 4:30803092-30803114 GGCTTCACTCTTCCCTGAATTGG - Intronic
972496293 4:39638311-39638333 GACTTCACCGTACCCAGAAAGGG + Intronic
976777408 4:88721469-88721491 GACTGCAAAGTCACCTGAATGGG + Intergenic
976836246 4:89377725-89377747 GAATTCACGTTGCTCTGAATGGG - Intergenic
978128509 4:105164707-105164729 GAATTCCCAGTTGCCTGAATAGG + Intronic
978482404 4:109208816-109208838 GAATACAAAGTGCCCTGAAGAGG + Intronic
982371610 4:154639348-154639370 GAGTTCACATGGACCTGAATAGG + Intronic
982543974 4:156710045-156710067 GACATGACAGGTCCCTGAATAGG + Intergenic
993477284 5:88380929-88380951 GAATTCAGAGTACCTTGAATTGG - Intergenic
993900783 5:93583049-93583071 GACTGGTCAGAGCCCTGAATCGG - Intergenic
996138012 5:119869010-119869032 GACTTCTAGGTGCCCTGAAAAGG + Intergenic
997122169 5:131186113-131186135 GACCTCACAGATCCCTGAAAGGG + Intronic
999160508 5:149492548-149492570 TACTTCACAGGGCGCTGATTAGG + Intronic
999279077 5:150352930-150352952 GACCTCGCCGTGCCCTGCATGGG + Intergenic
1000987098 5:167873101-167873123 GACTTCACAGTGCCTTGGTCAGG + Intronic
1001095061 5:168769606-168769628 GTGTTCACAGAGCCCTGCATAGG - Intronic
1006669499 6:35720828-35720850 GTCAGCACAGTGCCCGGAATGGG - Intronic
1008656432 6:53618717-53618739 GAGTTAAGAGTGCCATGAATGGG - Intergenic
1011282019 6:85687056-85687078 GACTTCTCTGTGCCCTGAACAGG + Intergenic
1011780096 6:90779023-90779045 CAATTCACATTGCCGTGAATTGG + Intergenic
1012883316 6:104816655-104816677 TACTAGACAGTGCCCTGTATGGG - Intronic
1016303232 6:142655198-142655220 AACTACACACTGCTCTGAATAGG - Intergenic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1018448974 6:163887751-163887773 GAATTCACAGGGCATTGAATAGG + Intergenic
1019155126 6:170033579-170033601 GACTTCACAGTGGTTTGCATGGG - Intergenic
1023877087 7:44292609-44292631 GACTTCTCAGGGCCTTGAATGGG + Intronic
1024107895 7:46111030-46111052 TACTTCACAGTGAACTGAGTGGG + Intergenic
1024127713 7:46317659-46317681 GACTTTCCAGTGTCATGAATGGG + Intergenic
1026830686 7:73608164-73608186 GGATTCACAGTGCCCTGTAGAGG - Intronic
1028982683 7:96983761-96983783 GGCTTCAGAGTGCCTTGGATGGG + Intergenic
1031632891 7:124065354-124065376 GACCTCACTGTGTCCAGAATTGG - Intergenic
1038667685 8:29554522-29554544 GAATTCACACAGCCTTGAATTGG - Intergenic
1039028786 8:33286926-33286948 GTCTTCAAAGTGCCCTGTTTTGG - Intergenic
1039392855 8:37195960-37195982 GACTTCACACTGGCCTGCCTTGG - Intergenic
1042425507 8:68643514-68643536 GACTTCTCAGTCTCCTGAAGTGG - Intronic
1047181386 8:122592129-122592151 GCATTCACAGTGACCTGGATGGG + Intergenic
1047670204 8:127137631-127137653 GTTTTCACAGTGCCCAGAACAGG + Intergenic
1049335223 8:142080721-142080743 GACTTCTCAGAGCCTTGAATCGG - Intergenic
1050310640 9:4349832-4349854 GCCTTCAGGGTGTCCTGAATTGG + Intergenic
1050326896 9:4506751-4506773 TAGTACACAGGGCCCTGAATAGG - Intronic
1054814545 9:69462602-69462624 GACTTCTCAGAGCCTTGAAGAGG + Intronic
1056121203 9:83491043-83491065 GACTTCACAGAGACTTCAATAGG - Intronic
1058027092 9:100153679-100153701 GACTTCCCAGTCTCCAGAATTGG - Intronic
1061393747 9:130332119-130332141 GACTGCCCAGGGCCCTGCATGGG + Intronic
1185956121 X:4492152-4492174 GACTTCAAAGTACCCTGAATTGG + Intergenic
1186326193 X:8479054-8479076 GACTTGACAGTGCCCAGGAATGG + Intergenic
1186714087 X:12231977-12231999 CTCTTAACAGTGCCCTGATTTGG - Intronic
1188366321 X:29319723-29319745 AACTTCACAATGCAATGAATGGG - Intronic
1188414285 X:29913777-29913799 AACTTCCCATTGCCCTGAAATGG + Intronic
1190089001 X:47421340-47421362 GACTCCCCAGTGCCTAGAATAGG + Intergenic
1190457458 X:50639991-50640013 GATTTCAGAGTGCCCAGAGTGGG + Intronic
1192550486 X:72049474-72049496 GAATTCCCAGTGCCCGGAGTGGG + Intergenic
1193698368 X:84736708-84736730 CACTTCCCAGTGTCCTGAGTAGG - Intergenic
1197964452 X:132043355-132043377 CACTTCAAAGTGCCCTGTGTGGG + Intergenic
1200068399 X:153515876-153515898 GACTTCCCATGGCCCCGAATGGG - Intergenic
1201329332 Y:12800900-12800922 GTCTTCACAATGCCTTGAAAAGG - Intronic