ID: 927552136

View in Genome Browser
Species Human (GRCh38)
Location 2:24010061-24010083
Sequence CCGCCCGCGGCCGTTGCCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927552136_927552142 -3 Left 927552136 2:24010061-24010083 CCGAGGGCAACGGCCGCGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 927552142 2:24010081-24010103 CGGCGCTGCGGTGGCAATGGCGG 0: 1
1: 0
2: 0
3: 8
4: 99
927552136_927552147 23 Left 927552136 2:24010061-24010083 CCGAGGGCAACGGCCGCGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 927552147 2:24010107-24010129 CCCCTGCACCAGCCGCCAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 182
927552136_927552143 21 Left 927552136 2:24010061-24010083 CCGAGGGCAACGGCCGCGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 927552143 2:24010105-24010127 GCCCCCTGCACCAGCCGCCAAGG 0: 1
1: 0
2: 0
3: 31
4: 297
927552136_927552141 -6 Left 927552136 2:24010061-24010083 CCGAGGGCAACGGCCGCGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 927552141 2:24010078-24010100 GGGCGGCGCTGCGGTGGCAATGG 0: 1
1: 0
2: 1
3: 13
4: 214
927552136_927552145 22 Left 927552136 2:24010061-24010083 CCGAGGGCAACGGCCGCGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 927552145 2:24010106-24010128 CCCCCTGCACCAGCCGCCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927552136 Original CRISPR CCGCCCGCGGCCGTTGCCCT CGG (reversed) Exonic
905037994 1:34929808-34929830 CCGCCCGCGGGCGGCGACCTCGG - Intergenic
905145235 1:35883084-35883106 CCGCCAGGGGCCGCTGCCTTGGG + Intronic
907319153 1:53592035-53592057 CCTCCCATGGCCCTTGCCCTGGG - Intronic
919539590 1:198830499-198830521 CCGCCCGTGGCTGTTGGACTTGG + Intergenic
921155160 1:212433229-212433251 CGGCCCGCGGCGGGCGCCCTGGG + Intronic
924511216 1:244730498-244730520 CCGCCCGGGGACGCTGCTCTGGG + Intergenic
1062842542 10:682146-682168 CCTCCAGCGGCCGTTGCTCTGGG - Intronic
1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG + Intronic
1077320411 11:1938461-1938483 GCGCCCGCCGACTTTGCCCTTGG - Exonic
1077479582 11:2807417-2807439 CCGCCCGCGGTCGCTGCACTGGG + Intronic
1078317765 11:10306511-10306533 GCGCCGGCGGCCGTAGCCCTGGG - Exonic
1083945176 11:65919405-65919427 CCGCCCGTCGCGGTTCCCCTGGG - Exonic
1091460941 12:643052-643074 CCGCAGGCGGCCGTAGCCCGCGG - Intronic
1096101012 12:48970493-48970515 CCGGCCGCGGCCTCCGCCCTCGG - Exonic
1101970569 12:109309585-109309607 CCGCCCACGTCCTTTGCCCCAGG - Intergenic
1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG + Exonic
1105240882 13:18609206-18609228 CCGACCGCGGCCGGTGCCTGAGG + Intergenic
1113794940 13:113051344-113051366 CCGCCCACCGCCGTGGCCCTGGG - Intronic
1114989076 14:28264526-28264548 CCGATCGCCGCAGTTGCCCTCGG + Intergenic
1116003271 14:39266902-39266924 CCGCCCGAGGCGGGTGCCCTTGG + Intronic
1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG + Intergenic
1119223243 14:72925995-72926017 GCGGCCGAGGCCGCTGCCCTGGG - Intergenic
1122140314 14:99659601-99659623 GCGCCCGCGGCCAGTGCCCGAGG - Exonic
1123490476 15:20775933-20775955 CCGACCGCGGCCGGTGCCTGAGG - Intergenic
1123546977 15:21345020-21345042 CCGACCGCGGCCGGTGCCTGAGG - Intergenic
1124109556 15:26773241-26773263 CGGCCCGAGGCCGGGGCCCTGGG + Intronic
1127606365 15:60591996-60592018 ACGCCCGCGGCCGGTCCCCAGGG - Intronic
1129606500 15:77027805-77027827 CCTCCCGAGGCCGCGGCCCTCGG + Intronic
1202955308 15_KI270727v1_random:72236-72258 CCGACCGCGGCCGGTGCCTGAGG - Intergenic
1132700738 16:1221009-1221031 CCGCCCACGGCTTTGGCCCTGGG + Exonic
1132744889 16:1432471-1432493 CCGCCCTCGACTGCTGCCCTCGG - Intergenic
1134070048 16:11255346-11255368 GCGCCCGCGGCCGTGCCCCGCGG - Exonic
1142764294 17:2056973-2056995 GCGGCCGCGGCCGTGGCCCCGGG + Exonic
1143536189 17:7541433-7541455 CCTCCCTCGGCCTTGGCCCTGGG - Intergenic
1144777493 17:17792059-17792081 CCTTCCGTGGCCGTGGCCCTGGG + Intronic
1145912900 17:28552642-28552664 CCGCCCCCGGCCGGGGCCCCAGG + Exonic
1146052884 17:29567048-29567070 CCGCCGGCGGCGGCTGCCCAGGG + Exonic
1148603091 17:48908708-48908730 CCGCCCTCAGCCGCTGCCCACGG + Exonic
1154448088 18:14450702-14450724 CCGACCGCGGCCGGTGCCTGAGG - Intergenic
1160983584 19:1827571-1827593 CCGCCCTCGGCCCTTGTCCTTGG + Exonic
1165928697 19:39342687-39342709 CCGCCCGCCGCCGCCGCCCGCGG - Intronic
927552136 2:24010061-24010083 CCGCCCGCGGCCGTTGCCCTCGG - Exonic
927943995 2:27123788-27123810 CCGCCCACCGCCGGTGCCCCGGG - Intronic
932621771 2:73269085-73269107 CCGGCCCCGGCCCTTGCCCCGGG - Exonic
937933029 2:127220121-127220143 CCGCCCGGCGCCTTTGTCCTCGG + Intergenic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
947461096 2:230305827-230305849 CCGCCAGAGGCCGTGTCCCTAGG + Intronic
1169367292 20:5001588-5001610 CCGCCCCCGACCCCTGCCCTCGG + Intronic
1174690919 20:52503760-52503782 CATCCCGCGGCAGCTGCCCTGGG + Intergenic
1175429197 20:58890644-58890666 GCGCCCGCGGCCTCTGCGCTTGG - Intronic
1176060743 20:63171640-63171662 CCACCCCAGGCCATTGCCCTAGG - Intergenic
1180559172 22:16601795-16601817 CCGCCCGCGGCCCCTCCCCCGGG - Intergenic
1181082537 22:20424644-20424666 CCCCCCTCGGCCGGTGCCCCAGG - Exonic
1181745457 22:24952708-24952730 CAGCCCGCGGCACCTGCCCTGGG - Intronic
1182345393 22:29660212-29660234 CAGCCCGCGGCGGGTGCCCTGGG - Intronic
1183708417 22:39488860-39488882 CCGCCCGCCGCCGTGCTCCTGGG - Exonic
1183781683 22:40002999-40003021 CCATCCACGGCAGTTGCCCTTGG + Intronic
955480514 3:59385090-59385112 CCACCCCCGGCCGGTGCCCACGG + Intergenic
956994275 3:74806120-74806142 CCGCACCCGGCCATTGCCCAAGG + Intergenic
967840762 3:194003151-194003173 GCGGCCGCGGCCCTTCCCCTGGG - Intergenic
967924172 3:194633341-194633363 CTGCCCGCGGTCGGTGCGCTCGG - Exonic
977908226 4:102501457-102501479 CCGCCAGCCGCCGCAGCCCTCGG + Exonic
978576950 4:110197771-110197793 CCGCCCGCCGCCCTTGGCCCTGG - Intronic
994229969 5:97301288-97301310 CCCTCCGCAGCCGCTGCCCTGGG - Intergenic
997402169 5:133611866-133611888 CGGCCCGGGCCCGGTGCCCTTGG - Intronic
1002200295 5:177524225-177524247 GCGGCTGCGGCCCTTGCCCTGGG + Exonic
1003058259 6:2841910-2841932 CCGCCCGCGGCTGCTGGCCCGGG - Exonic
1006303624 6:33206927-33206949 CCGGCGGCGGGGGTTGCCCTGGG - Intergenic
1006466303 6:34196786-34196808 CCGCCTGGGGCCGATGCCTTAGG + Intergenic
1006601888 6:35231740-35231762 CTGACAGCCGCCGTTGCCCTCGG - Exonic
1013441790 6:110179212-110179234 GCGCCCGCCGCCGTCTCCCTCGG + Intronic
1014137711 6:117907818-117907840 CCCGCCGCCGCCGCTGCCCTCGG - Exonic
1014913547 6:127119719-127119741 CCGCGCGAGGCGGTTGCGCTAGG - Intronic
1017174988 6:151494205-151494227 CCGCGCGCGGGGGTGGCCCTGGG + Intronic
1022092011 7:27113916-27113938 CGGGCCGCGGCTGCTGCCCTCGG - Intronic
1022207611 7:28179786-28179808 CCGCCCGCGGCCGCCGGCCCCGG + Intronic
1024965305 7:55018866-55018888 CCTCCGGCGGCCGCTGGCCTTGG + Intergenic
1034171428 7:149065874-149065896 TCGGCGGCGGCCGTTGCCCAGGG + Intergenic
1034560482 7:151876677-151876699 CCTCCCCCGGCCGCTGCCTTCGG + Exonic
1044719761 8:95134013-95134035 CCGCCCGCGGCCGTCGGGGTAGG + Exonic
1047393725 8:124475033-124475055 CCGCCCCCGGCCGCGGCCCCGGG + Exonic
1049668347 8:143858801-143858823 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049668763 8:143860400-143860422 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049669178 8:143862002-143862024 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049669593 8:143863604-143863626 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049670003 8:143865197-143865219 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1053149205 9:35732201-35732223 CCACCCGCGGGCGGCGCCCTGGG + Exonic
1061494353 9:130963150-130963172 TCTCCCACGGCCCTTGCCCTAGG - Intergenic
1062390579 9:136332096-136332118 CCGCCCGCTGCTGCTGCCCGTGG + Intronic
1062556353 9:137114869-137114891 CGCCCCGCGGCCGCTGCCCAGGG + Intronic
1189054616 X:37685879-37685901 GCGGCGGCGGCCGTTGCCCGAGG - Exonic