ID: 927553076

View in Genome Browser
Species Human (GRCh38)
Location 2:24015938-24015960
Sequence GAGTACTAATGGGAGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927553066_927553076 20 Left 927553066 2:24015895-24015917 CCCCAGATGAGGGCCCTGGAGTC 0: 1
1: 0
2: 0
3: 25
4: 214
Right 927553076 2:24015938-24015960 GAGTACTAATGGGAGTGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 96
927553071_927553076 6 Left 927553071 2:24015909-24015931 CCTGGAGTCCTCTCCGCAGTGGC 0: 1
1: 0
2: 0
3: 16
4: 164
Right 927553076 2:24015938-24015960 GAGTACTAATGGGAGTGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 96
927553072_927553076 -2 Left 927553072 2:24015917-24015939 CCTCTCCGCAGTGGCTGACATGA 0: 1
1: 0
2: 1
3: 9
4: 112
Right 927553076 2:24015938-24015960 GAGTACTAATGGGAGTGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 96
927553073_927553076 -7 Left 927553073 2:24015922-24015944 CCGCAGTGGCTGACATGAGTACT 0: 1
1: 0
2: 0
3: 21
4: 175
Right 927553076 2:24015938-24015960 GAGTACTAATGGGAGTGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 96
927553069_927553076 7 Left 927553069 2:24015908-24015930 CCCTGGAGTCCTCTCCGCAGTGG 0: 1
1: 0
2: 1
3: 20
4: 115
Right 927553076 2:24015938-24015960 GAGTACTAATGGGAGTGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 96
927553067_927553076 19 Left 927553067 2:24015896-24015918 CCCAGATGAGGGCCCTGGAGTCC 0: 1
1: 0
2: 1
3: 29
4: 344
Right 927553076 2:24015938-24015960 GAGTACTAATGGGAGTGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 96
927553068_927553076 18 Left 927553068 2:24015897-24015919 CCAGATGAGGGCCCTGGAGTCCT 0: 1
1: 0
2: 1
3: 17
4: 189
Right 927553076 2:24015938-24015960 GAGTACTAATGGGAGTGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 96
927553064_927553076 24 Left 927553064 2:24015891-24015913 CCAGCCCCAGATGAGGGCCCTGG 0: 1
1: 0
2: 4
3: 36
4: 392
Right 927553076 2:24015938-24015960 GAGTACTAATGGGAGTGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927553076 Original CRISPR GAGTACTAATGGGAGTGTGC AGG Intronic
901214890 1:7549793-7549815 GAGTAAGAATGGGAGGGTGAGGG + Intronic
903007360 1:20307464-20307486 GAGGCCTCAAGGGAGTGTGCTGG - Intronic
905341912 1:37284058-37284080 GAGTCCTAAAGGGATTGGGCAGG - Intergenic
913718300 1:121562334-121562356 CAGTAGTAATGGGAGTGTAAAGG + Intergenic
914433399 1:147639909-147639931 AAGCAGTAAAGGGAGTGTGCCGG - Intronic
914728328 1:150348029-150348051 GAACACTAATGGGAGTATGATGG - Intronic
915063885 1:153209008-153209030 GAGTAATTATGGGATTCTGCAGG - Intergenic
916448298 1:164894457-164894479 TAGTACTCTTGGGACTGTGCAGG - Intronic
919600653 1:199618232-199618254 GAGTTCCAATGGCAGTGAGCTGG - Intergenic
921008401 1:211116391-211116413 GAGTACTACTAGGACTGTGAGGG - Intronic
921560431 1:216651917-216651939 TAGTACCAATGGCAGTGTGTGGG + Intronic
924269486 1:242318125-242318147 GAGTAATAATGGCATTGTGTAGG + Intronic
1062808908 10:447460-447482 GAGTATCGATGGGAGTGAGCGGG - Intronic
1062808917 10:447510-447532 GAGTATTGATGGGAGTGAGCGGG - Intronic
1062809100 10:448507-448529 GAGTATCAACGGGAGTGAGCGGG - Intronic
1062809109 10:448557-448579 GAGTATCAACGGGAGTGAGCGGG - Intronic
1062809137 10:448709-448731 GAGTATTGATGGGAGTGAGCGGG - Intronic
1066782680 10:38970066-38970088 GAGTAATAATGGCATTGTGTAGG + Intergenic
1071689247 10:87797986-87798008 GGGGCCTAATGGGAGTGTACAGG + Intronic
1072010323 10:91297894-91297916 CAGTTTTAATGGGAGTGTCCCGG + Intergenic
1073358167 10:102873671-102873693 GCTTACTAATGGGAGAGAGCTGG + Intronic
1075109481 10:119566569-119566591 CACTCCTAATGGGAATGTGCTGG - Intergenic
1076854250 10:133108149-133108171 GAGCACACCTGGGAGTGTGCAGG + Intronic
1080635715 11:34121521-34121543 GTGTACAAATGGGAATGTACAGG + Intronic
1083131957 11:60633144-60633166 GAGTATTAAGGGGAGAGTGCTGG + Intergenic
1084072677 11:66746290-66746312 GAATAATAATGGGAGTTGGCCGG + Intronic
1084435425 11:69136612-69136634 GAGGACTGATGGGTGAGTGCAGG + Intergenic
1085267167 11:75243743-75243765 GAGTACTGATGGGGGTGGGAGGG + Intergenic
1085558512 11:77447951-77447973 GAGTTCAAATGGGAGTGTGGTGG - Intronic
1086068868 11:82776584-82776606 CACCACTAATGGGACTGTGCTGG - Intergenic
1111651111 13:91092004-91092026 GCATACTAATGGGAGAGTTCTGG + Intergenic
1112645089 13:101321480-101321502 TAGTACTGGTGGGAGTATGCAGG + Intronic
1119484520 14:74979065-74979087 GAGGAGTAATGGGTGTGTGGTGG - Intergenic
1120433987 14:84456821-84456843 GAGTACTAATGAGAGTATTTAGG + Intergenic
1123430644 15:20213027-20213049 GAGAACTAGTGAGAGTATGCAGG - Intergenic
1124841917 15:33250178-33250200 GTGTACTAATGGGAGAGTACAGG - Intergenic
1127152723 15:56094715-56094737 GAGTACCAATGGGTGTATGTCGG + Exonic
1127227633 15:56950137-56950159 GAGTAGGGATGGGAGTGTGAAGG - Intronic
1130423119 15:83768091-83768113 AAGTACAAATGGGAGAGAGCTGG + Intronic
1132872388 16:2121718-2121740 GAGCACTACTGGGAGTGCGTGGG - Intronic
1134551444 16:15140799-15140821 GAGCACTACTGGGAGTGCGTGGG - Intergenic
1136853995 16:33638198-33638220 GAGAACTAGTGAGAGTATGCAGG + Intergenic
1138403839 16:56772146-56772168 CATTGCTAATGGGAGTGTACCGG + Intronic
1138624786 16:58242273-58242295 GAGGAGAAATGGGAGTGTGATGG - Intronic
1139346526 16:66307349-66307371 AAGTAGCAATGGGTGTGTGCAGG + Intergenic
1141500637 16:84441995-84442017 GAGAAGTAATGCGAGTGTCCAGG + Intronic
1203115576 16_KI270728v1_random:1486634-1486656 GAGAACTAGTGAGAGTATGCAGG + Intergenic
1147245209 17:39115710-39115732 GAGTGGTGATGGGAGAGTGCTGG + Intronic
1147926900 17:43952149-43952171 GAGGAGCAATGGGAGTGTGGAGG - Intergenic
1149007689 17:51822504-51822526 TAGTAATAATGGGAGAATGCAGG - Intronic
1149239883 17:54636283-54636305 CACTACTATTGGGACTGTGCTGG - Intergenic
1153152025 18:2106454-2106476 TAGTACTAATGGTAATGAGCTGG - Intergenic
1153747739 18:8197871-8197893 GAGTTCCAATGAGAGTGTGTCGG - Intronic
1157848488 18:51026287-51026309 GAGTACTATAGGGAGTGATCTGG + Intronic
1158821953 18:61170518-61170540 GCATACCAATGGGATTGTGCTGG + Intergenic
1159869892 18:73748892-73748914 GCATACTAATGAGAATGTGCTGG - Intergenic
1163544289 19:17931957-17931979 GAGAGCTAATGGGAGGGTGAGGG + Intergenic
1167038474 19:47008282-47008304 GAGCAGGAAGGGGAGTGTGCTGG - Intergenic
927553076 2:24015938-24015960 GAGTACTAATGGGAGTGTGCAGG + Intronic
931419354 2:62111815-62111837 GACTACTAATGGGACTGTTGGGG - Intronic
943508163 2:188788144-188788166 GAGTAATAAAGGGAGTGTACTGG + Intronic
944167638 2:196740220-196740242 GAGTTCTAATTTGATTGTGCTGG + Intronic
1173936961 20:46874960-46874982 GAGTTCAAATGAGAGTTTGCTGG - Intergenic
949793649 3:7822630-7822652 GAGTGCTGAAGGGAGGGTGCTGG + Intergenic
955212480 3:56954878-56954900 GAGGACTAATGGAGGTCTGCAGG + Intronic
956153590 3:66269531-66269553 GATTCCTAATGGAAGTGTGTTGG + Intronic
956517149 3:70061971-70061993 GAGAACGAATGGGAGTCTGGGGG - Intergenic
956650141 3:71497534-71497556 GACTGCAAATGTGAGTGTGCAGG + Intronic
957156716 3:76552833-76552855 GTTTAGTAATGGGAGTGTGAGGG + Intronic
957315996 3:78577678-78577700 GAGTACTAATGTGGGCGTGTTGG + Intergenic
958485947 3:94708836-94708858 GATTACTAATGAGAGTCTGCAGG - Intergenic
959933616 3:112008156-112008178 GATTATTTATGGGAGTTTGCAGG - Intronic
960019283 3:112931797-112931819 GAGTATCAAAGGGAGAGTGCAGG + Intronic
961162974 3:124745244-124745266 GAGAAGGAATGTGAGTGTGCTGG - Intergenic
964256438 3:154779734-154779756 AAGTAATAATGTGAGTGTGCTGG - Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972653057 4:41038446-41038468 GAGGAGTTATGGGACTGTGCAGG - Intronic
973369176 4:49231424-49231446 GAGTACTAGAGGGAGTGGGAGGG - Intergenic
973391862 4:49563992-49564014 GAGTACTAGAGGGAGTGGGAGGG + Intergenic
977262909 4:94819457-94819479 GAGTTTTGATGGGAGTGTCCAGG + Intronic
977802687 4:101256534-101256556 GAGTACTAACAGTAGTGAGCAGG - Intronic
978202151 4:106034846-106034868 GAGTGCTAATGGCAATGAGCTGG - Intergenic
979927148 4:126582252-126582274 GAATATTAAAGGGAGAGTGCTGG + Intergenic
984214739 4:176896363-176896385 GAGTAGTAATGAGTGTGTGAAGG - Intergenic
985381477 4:189399315-189399337 GAGTTCTCATGGGAGTGGGCTGG + Intergenic
989960290 5:50405724-50405746 CAGTAGTAATGGGAGTGTAAAGG - Exonic
991047881 5:62241993-62242015 GAGAACTAGTGAGAGTATGCAGG - Intergenic
994704872 5:103191091-103191113 GAGTACAAAGGGGAGTGTAAAGG + Intronic
995194412 5:109347656-109347678 GAGTATTTATGGTACTGTGCTGG - Intronic
998230518 5:140358743-140358765 TAGGAGTAATGGGAGTGTGTTGG + Intergenic
1001187794 5:169592754-169592776 GAGTAATAAAGGGAGTATTCAGG + Intronic
1007275351 6:40669295-40669317 GAGAAATAATGGGAGATTGCAGG - Intergenic
1011435440 6:87331228-87331250 AAGTTCTGATGGAAGTGTGCTGG + Intronic
1026791706 7:73337024-73337046 GATTACTCATGGGAATGAGCAGG + Intronic
1031840146 7:126728153-126728175 GAGCACTAATGGCAGTGGGGAGG - Intronic
1031996591 7:128236065-128236087 GAGTAGAGATGGGAGTTTGCTGG - Intergenic
1037519358 8:19664878-19664900 GATTACTAATGGGAGGATGGGGG + Intronic
1038419591 8:27423946-27423968 TATTACTAATGGCAGTGAGCTGG - Intronic
1045767604 8:105692953-105692975 GAGAAAGTATGGGAGTGTGCAGG + Intronic
1061084599 9:128391741-128391763 CAGTATTAATTGGGGTGTGCTGG - Exonic
1189411779 X:40779231-40779253 CACTACTATTGGGACTGTGCTGG + Intergenic
1192590769 X:72357624-72357646 GAGGCCTAATGGGAGTGAGGAGG + Intronic
1193436334 X:81478647-81478669 GAGTGCTAAGGGGAGAGTGCTGG + Intergenic
1193741878 X:85226825-85226847 GGGTGCTAAAAGGAGTGTGCTGG - Intergenic
1196670265 X:118358728-118358750 GAGTACTAATCTGTGTGTGGTGG - Intronic
1200874753 Y:8141488-8141510 GATTTCTAATGGAAATGTGCTGG - Intergenic
1201692707 Y:16786438-16786460 GAGTAAAAAAGGAAGTGTGCTGG - Intergenic