ID: 927554497

View in Genome Browser
Species Human (GRCh38)
Location 2:24022558-24022580
Sequence ACCACACATGTCCCCAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 2, 1: 0, 2: 2, 3: 19, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927554497_927554498 -3 Left 927554497 2:24022558-24022580 CCTGAGCTGGGGACATGTGTGGT 0: 2
1: 0
2: 2
3: 19
4: 219
Right 927554498 2:24022578-24022600 GGTCCTTGATGTGACACATATGG 0: 1
1: 0
2: 0
3: 7
4: 113
927554497_927554501 12 Left 927554497 2:24022558-24022580 CCTGAGCTGGGGACATGTGTGGT 0: 2
1: 0
2: 2
3: 19
4: 219
Right 927554501 2:24022593-24022615 ACATATGGCCAGAGTTCTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 143
927554497_927554503 24 Left 927554497 2:24022558-24022580 CCTGAGCTGGGGACATGTGTGGT 0: 2
1: 0
2: 2
3: 19
4: 219
Right 927554503 2:24022605-24022627 AGTTCTGGTGGTCAACATTTTGG 0: 1
1: 0
2: 0
3: 15
4: 162
927554497_927554500 9 Left 927554497 2:24022558-24022580 CCTGAGCTGGGGACATGTGTGGT 0: 2
1: 0
2: 2
3: 19
4: 219
Right 927554500 2:24022590-24022612 GACACATATGGCCAGAGTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927554497 Original CRISPR ACCACACATGTCCCCAGCTC AGG (reversed) Intronic
900195025 1:1371718-1371740 ACCACAGATGTCTCCAGATGCGG + Intergenic
900379319 1:2375993-2376015 ACCCCACATGTGGTCAGCTCTGG - Intronic
900729873 1:4249835-4249857 ACCACCCATGTAACCAGCTTAGG - Intergenic
901661368 1:10799859-10799881 ACCAAGCTTGTCCCCACCTCAGG + Intergenic
902379040 1:16044025-16044047 AGCACCCCTGACCCCAGCTCAGG - Intronic
903768382 1:25749144-25749166 CCCATACCTGTCCCCGGCTCTGG - Intronic
904349328 1:29894598-29894620 AGCCCACATGCCCCCAGTTCTGG - Intergenic
904593485 1:31628301-31628323 ACCACACATTCCACCTGCTCTGG - Intronic
904615858 1:31749242-31749264 ACCACACCACTCCCCAGCTGAGG + Intronic
905630700 1:39516553-39516575 GGAATACATGTCCCCAGCTCTGG + Intronic
905667060 1:39769617-39769639 GGAATACATGTCCCCAGCTCTGG - Exonic
906329461 1:44872680-44872702 ACCACTCCTTTCTCCAGCTCAGG + Intronic
906482198 1:46206421-46206443 ACCATACAGGACCCCAGCGCTGG + Intronic
907405783 1:54252593-54252615 ACCGCCGATGGCCCCAGCTCTGG - Intronic
910216670 1:84850730-84850752 ACCACAGATCCCCCCGGCTCAGG + Intronic
910820447 1:91339258-91339280 ACCACACAGCTCCCCAGCAATGG + Intronic
911069150 1:93818407-93818429 ACCACGCAAGTCCCCACCTCAGG + Intronic
911831869 1:102560450-102560472 ACCACACATGTACCCAGGACAGG - Intergenic
914847997 1:151293342-151293364 ACCAGATAAGTGCCCAGCTCAGG - Intronic
917304870 1:173614671-173614693 AACACACATGTTCCCAGCAAAGG + Intronic
919315840 1:195969770-195969792 ACCACCCATGTCCACAGCCTCGG - Intergenic
920394595 1:205635021-205635043 TCCACACTTGTCCCCACCTGGGG - Intergenic
921188351 1:212688828-212688850 ACCATGCATTTCCCAAGCTCAGG + Intronic
922326806 1:224535821-224535843 ACTACCGCTGTCCCCAGCTCTGG - Intronic
922965604 1:229688546-229688568 ACCAATAATGTCTCCAGCTCTGG + Intergenic
923781861 1:237031996-237032018 ACCTCACCTCTCCCCAGCCCCGG + Intergenic
924202251 1:241672384-241672406 GCCACACTTCTCCCCTGCTCTGG - Intronic
1063624239 10:7674360-7674382 AACAAACATTTCCCAAGCTCAGG - Intergenic
1064391065 10:14942638-14942660 AACACTTCTGTCCCCAGCTCAGG - Intronic
1066006862 10:31153832-31153854 ACCAAACATAAACCCAGCTCTGG - Intergenic
1066529834 10:36325237-36325259 AACACACACGTTCCCAGCTGAGG + Intergenic
1067087927 10:43252660-43252682 CCCTCACATGTCCTAAGCTCAGG + Intronic
1067238477 10:44471228-44471250 ACCCCCCATGTCCTCAGCTAAGG + Intergenic
1067740746 10:48894611-48894633 AGCAAACATGTCCTGAGCTCAGG + Intronic
1069888300 10:71637657-71637679 ACCAACCCTGTCCCCAACTCGGG - Intronic
1070776361 10:79112175-79112197 AACACACCTGTCCCCTACTCAGG - Intronic
1071438039 10:85665247-85665269 ACCACACATGTTTACAGCTGTGG + Intronic
1071812406 10:89198045-89198067 ACCACCCTGGGCCCCAGCTCTGG + Intergenic
1073475042 10:103747221-103747243 TCCACCCCTCTCCCCAGCTCTGG - Intronic
1074279626 10:112038549-112038571 ACCACCACTGTCCCCAGCTAGGG + Intergenic
1074492836 10:113954625-113954647 ACCCCCCATCTCCCCAGTTCAGG - Intergenic
1074707525 10:116148333-116148355 ACCACACATGCTTCCAGCTATGG - Intronic
1075808973 10:125210526-125210548 ACCACCCAGGAACCCAGCTCAGG - Intergenic
1076491184 10:130862680-130862702 TCCACACAGGCCTCCAGCTCAGG - Intergenic
1077323161 11:1951485-1951507 AGTTCACAGGTCCCCAGCTCAGG + Intronic
1077492229 11:2866902-2866924 ACCACACCTACCCCCAGCTCAGG + Intergenic
1083827913 11:65213613-65213635 ACCACCCATATCCGCAGGTCTGG - Intergenic
1084405226 11:68968212-68968234 GCCACATATGTCCCCAGTCCTGG + Intergenic
1085337002 11:75703922-75703944 ACTAGACAAGTCCTCAGCTCAGG - Intergenic
1089579932 11:119475266-119475288 CCCAGGCATGACCCCAGCTCGGG - Intergenic
1089901676 11:121993046-121993068 ACCACCCATGCCTCCAGCCCAGG + Intergenic
1202806147 11_KI270721v1_random:6680-6702 AGTTCACAGGTCCCCAGCTCAGG + Intergenic
1095727573 12:45470078-45470100 ACCACAGATCTCCCCAGCCCCGG + Intergenic
1096102674 12:48979048-48979070 ACCACAGGTTTCCCCACCTCGGG + Intronic
1097265982 12:57745141-57745163 ACAAACCATCTCCCCAGCTCTGG - Exonic
1100275925 12:93071811-93071833 GCCTCTCATGTCCCCATCTCAGG - Intergenic
1102013450 12:109632871-109632893 ATCAAACGTGCCCCCAGCTCTGG + Intergenic
1102198359 12:111040448-111040470 ATCAAGCATGTCCCCACCTCAGG + Intronic
1102347295 12:112168265-112168287 ACCAAACAAGTCCACAACTCAGG - Intronic
1103329974 12:120147392-120147414 ACCCCACAAGTCACCAGCTGGGG + Intronic
1103880748 12:124164123-124164145 ACCCCACATTTCCCCTGCACTGG + Intronic
1104093202 12:125533045-125533067 ATCTCACATCTCCCCAGCTGTGG - Intronic
1104286671 12:127430647-127430669 ATCACACATGTAGCCAGCTCAGG - Intergenic
1104300722 12:127562721-127562743 ACCACAAATATCCCCACCCCCGG - Intergenic
1104927736 12:132322309-132322331 AGCAGAGATGTCCCCACCTCAGG - Intronic
1108029418 13:46213414-46213436 AACACACATGCCTCCAGCTGAGG + Intronic
1109273954 13:60283688-60283710 AGCACACATGCCCCCAACCCAGG - Intergenic
1113466364 13:110516288-110516310 AGCACACCTGGCCCCAGATCTGG + Intergenic
1114653475 14:24301613-24301635 AGCACAGAAGACCCCAGCTCAGG + Exonic
1118629758 14:67691918-67691940 CCCACACATGATGCCAGCTCGGG + Intronic
1122074446 14:99227002-99227024 AACACACAGGATCCCAGCTCAGG - Intronic
1122269557 14:100562461-100562483 CCCACAGCTGTCCCCACCTCGGG + Intronic
1202904167 14_GL000194v1_random:59101-59123 ACCATCCCTGTCCCCACCTCGGG + Intergenic
1125883798 15:43213825-43213847 GCCCCACCTGTCCTCAGCTCAGG - Intronic
1126663630 15:51055881-51055903 ACCAGCCATCTCCCCAGCCCAGG + Intergenic
1128798326 15:70480511-70480533 ACCCCACCTGCCCCCAGCCCAGG + Intergenic
1128812043 15:70579993-70580015 CCCACCCATGTCCCCAGTCCTGG - Intergenic
1129156676 15:73722462-73722484 ACCACACTTGTCACCAGACCTGG - Intergenic
1130988264 15:88858806-88858828 TCCACTAATGTCCCCAGCTGTGG - Exonic
1132804156 16:1768052-1768074 TCCTCCCATGTCCCCAGCTGTGG + Exonic
1133622722 16:7542023-7542045 CCCACACTTCTTCCCAGCTCAGG - Intronic
1136267271 16:29129093-29129115 ACCTCAGGTGACCCCAGCTCCGG + Intergenic
1139464845 16:67149011-67149033 ACCAGACATATCCACTGCTCTGG + Exonic
1139516396 16:67454857-67454879 CCCAGCCATGTCCCCACCTCAGG + Intronic
1139651528 16:68364711-68364733 CCCACTCAGGTCTCCAGCTCTGG - Intronic
1140699575 16:77568850-77568872 ACCAGGCATGGTCCCAGCTCAGG + Intergenic
1140732649 16:77870644-77870666 AACACAAATAGCCCCAGCTCGGG - Intronic
1140906087 16:79410527-79410549 TCCACATATGTACCCAGCGCAGG - Intergenic
1141264167 16:82480913-82480935 GACACACATGTTCCCAGCTGAGG + Intergenic
1141551919 16:84812005-84812027 ACCACAAAAGTCCCCAGCAGTGG - Intergenic
1141687511 16:85578733-85578755 ACCACACATGGCCCCACCTCAGG + Intergenic
1142070564 16:88089416-88089438 ACCTCAGGTGACCCCAGCTCCGG + Intronic
1142230296 16:88896993-88897015 CGCACACGTGTCCCCAGCTGAGG + Intronic
1143460669 17:7101526-7101548 ACCCCACACCTGCCCAGCTCTGG - Exonic
1143753609 17:9050378-9050400 ACCACGCCTGGCCCCAGCTAGGG - Intronic
1144890019 17:18489184-18489206 AACACCCAGGTCCCCGGCTCTGG - Intronic
1145142197 17:20455133-20455155 AACACCCAGGTCCCCGGCTCTGG + Intronic
1147133794 17:38423870-38423892 CCTACACCTGGCCCCAGCTCAGG - Intergenic
1147393410 17:40123064-40123086 CCCACCCTTGTCCCCAGCCCAGG - Intronic
1147776712 17:42907067-42907089 ACCAAACACGTTCCCACCTCAGG - Intronic
1150832279 17:68534471-68534493 AACACACATGTTCCCAACTGAGG + Intronic
1151444162 17:74152412-74152434 ACTACAAATGTCCTCATCTCAGG - Intergenic
1151885409 17:76920640-76920662 AGCCCACATGTCCCCAGCCCTGG - Intronic
1152232148 17:79119222-79119244 ACCACAGATGCCCTCAGATCTGG - Intronic
1152475273 17:80513824-80513846 ACCAGACATCTCCCCACCTCAGG + Intergenic
1153149092 18:2069863-2069885 CACACACATCTCCCCAGCCCTGG + Intergenic
1156877465 18:42032199-42032221 GCCACACATGCTCCCACCTCCGG - Intronic
1157508368 18:48248369-48248391 GCCACATATGTTCCCATCTCAGG + Intronic
1158587088 18:58749525-58749547 AGTACACATGTTCCCAGCTGAGG - Exonic
1160716193 19:577897-577919 ACGACACCTGCTCCCAGCTCTGG + Exonic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG + Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161076168 19:2286848-2286870 CCCCCACCTGTCCCCAGCTGGGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161515309 19:4693096-4693118 ACCACAGATGTCCCTAGATGTGG - Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161562986 19:4984038-4984060 ATCACAAATGTCCCCAGCTGTGG - Intronic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161942770 19:7415956-7415978 CCCACACAGGTTCCCAGCTGAGG + Intronic
1162148211 19:8626605-8626627 TACACACCTGTCCCCAGCTGAGG - Intergenic
1162581569 19:11534361-11534383 CCCAAACATGTTCCCACCTCAGG - Intergenic
1163497322 19:17654553-17654575 AACACAGCTGTCCCCAGCCCAGG + Intronic
1165392988 19:35548989-35549011 AGCTCACATGTCCTCTGCTCAGG - Intergenic
1165707435 19:37986560-37986582 ACCACACAGGCCCCCAACGCTGG - Intronic
1165746225 19:38231186-38231208 GCCACACTTGTTCCCAGCCCAGG - Intergenic
1165902717 19:39176275-39176297 GCCACCCCTGTTCCCAGCTCCGG + Intronic
1167768173 19:51497967-51497989 AACACACATGTCCCACCCTCAGG - Intronic
1168254823 19:55159566-55159588 GCCACACAGGCCCCAAGCTCAGG + Exonic
926312346 2:11683777-11683799 ACCACACCTGTCCCTTCCTCAGG - Intronic
926414599 2:12636696-12636718 AACAAACATGTGCCCAGCTCTGG - Intergenic
927411074 2:22826961-22826983 CCCACCCATTTCCCCAACTCTGG - Intergenic
927554028 2:24020127-24020149 ACCACACATGTCCCCAGCTCAGG - Intronic
927554497 2:24022558-24022580 ACCACACATGTCCCCAGCTCAGG - Intronic
928524949 2:32130427-32130449 ACCACACCTGGCCTCACCTCTGG - Intronic
929593457 2:43161464-43161486 ACCACACCTGGCCCCAAGTCAGG + Intergenic
929921207 2:46172768-46172790 ACCACAAGGGTCCCCAGCACAGG - Intronic
937913864 2:127089483-127089505 CCAACACGTGTCCCCATCTCAGG - Intronic
938062911 2:128266526-128266548 ACCTCACCTGACCCCAGCTTCGG + Exonic
943445567 2:187982771-187982793 GATACACATGTCCCCAGCTAAGG + Intergenic
943861390 2:192868446-192868468 CTCACACAAGTCCCCAGGTCAGG + Intergenic
944076625 2:195739802-195739824 CCAACACACGTTCCCAGCTCGGG + Intronic
945543214 2:211115252-211115274 CCCACATTTGTTCCCAGCTCTGG + Intergenic
946163175 2:217848242-217848264 ACCCCAGCTGCCCCCAGCTCCGG - Exonic
946763890 2:223022259-223022281 ACCAAACATGTCTCCAGGCCGGG + Intergenic
1169630513 20:7625869-7625891 CCCACACATGGGCCCTGCTCTGG - Intergenic
1170520626 20:17180830-17180852 ACCACACTTGTTCCCAGCAATGG + Intergenic
1170824683 20:19783542-19783564 TCCAGACAGCTCCCCAGCTCAGG - Intergenic
1171221509 20:23402252-23402274 AACACCCACGTCCCCTGCTCTGG + Intronic
1172113638 20:32561510-32561532 ACCACACCTGTCCCCTGCTCTGG - Intronic
1172771899 20:37386855-37386877 ACAGCACATGGCCCCAGCCCAGG + Intronic
1173245801 20:41336618-41336640 ATCACACAAATCCCCATCTCAGG + Intergenic
1173654668 20:44691380-44691402 TCAATACATGTCCCCAGCTCTGG + Intergenic
1174390969 20:50218057-50218079 TCCCCACGTGTCCCCAGCTGGGG + Intergenic
1175611359 20:60353783-60353805 TCCTCATATGTTCCCAGCTCTGG - Intergenic
1176623534 21:9073868-9073890 ACCATCCCTGTCCCCACCTCGGG + Intergenic
1179805205 21:43832886-43832908 ACCTCACATGTCACCTGCTCGGG - Intergenic
1179883288 21:44302325-44302347 TCCACACACTTCCCCAGTTCAGG + Intronic
1180741468 22:18055996-18056018 ACAAGACAAGTCCCCAGCTCTGG - Intergenic
1180799059 22:18623436-18623458 GCCACACACATCCCCAACTCCGG - Intergenic
1180971914 22:19820306-19820328 ACCTCAGATGTCACCAGCCCTGG + Intronic
1181222659 22:21371830-21371852 GCCACACACATCCCCAACTCCGG + Intergenic
1181638420 22:24184819-24184841 GCCACACACATCCCCAACTCCGG + Exonic
1183244697 22:36684985-36685007 ACCACACACCACCGCAGCTCAGG - Intronic
1183614770 22:38937255-38937277 ACCACACAGGGCCCCAGCCCAGG + Intergenic
1183911003 22:41079238-41079260 ACCACACATGGCATCAGCTTAGG + Intergenic
1184531957 22:45061882-45061904 ACCACAGGATTCCCCAGCTCCGG - Intergenic
1184628288 22:45755081-45755103 GCCACACATGTGACCAGCACAGG - Intronic
950111095 3:10419172-10419194 AGCACACACATCCCCATCTCTGG - Intronic
950227142 3:11245061-11245083 ACCACACCTGGCCCTAACTCAGG - Intronic
954654489 3:52185716-52185738 CCCACAAATGGCCCCATCTCTGG + Intergenic
954854102 3:53627673-53627695 ACTAGACATCTCCCCAGCCCAGG - Intronic
960201447 3:114841795-114841817 ACCACATATTTCTCCAGCTCAGG - Intronic
966019877 3:175195558-175195580 ATCACATATGTTCCCATCTCAGG - Intronic
966261525 3:177984619-177984641 GCCTCACCTGTCCCCAACTCTGG + Intergenic
966864411 3:184249262-184249284 AACACAGATGTTCCCAGCGCAGG - Intronic
967381657 3:188865881-188865903 AAAACACATGTCCTCAGTTCTGG + Intronic
967539531 3:190649305-190649327 ACCACCCTTGTCCTCATCTCAGG + Intronic
968554979 4:1242283-1242305 CCCACACCTGGCCCCTGCTCTGG + Intronic
968599493 4:1502361-1502383 TCCACGCTTGTCACCAGCTCTGG - Intergenic
968913784 4:3488357-3488379 CCCACACAGGTGCCCAGCTGGGG - Intronic
968974509 4:3814219-3814241 TCCTCACATGGCCCCACCTCTGG + Intergenic
972460791 4:39300229-39300251 AGCACACCTCTCACCAGCTCTGG + Intronic
974669895 4:65015865-65015887 ACTACACATGTGCACAGCTAGGG - Intergenic
978922841 4:114205437-114205459 AACAAACATGTCCACAGCTCTGG - Intergenic
985570523 5:642338-642360 AGCACACATGGCCCCTTCTCTGG + Intronic
989425334 5:41290251-41290273 ACCACACATGGCTTCTGCTCTGG + Intergenic
996171534 5:120298374-120298396 GGCACACATTCCCCCAGCTCAGG + Intergenic
997352437 5:133240560-133240582 ACCACACATGCCCCGAGCCTTGG - Intronic
997733911 5:136199738-136199760 CCCACCTAGGTCCCCAGCTCAGG - Intergenic
999327652 5:150653043-150653065 CCCACACATGTGCCCTGCTTTGG + Exonic
1000448673 5:161357323-161357345 ACCACACATGTTCCTGGCTTTGG - Intronic
1001245647 5:170104396-170104418 ACCACCCATGGCCCAAGCTGAGG + Intergenic
1001251957 5:170153414-170153436 ACCACACACGACCCCTGCTGAGG + Intergenic
1001311463 5:170613962-170613984 ACAAGAGATGGCCCCAGCTCCGG + Intronic
1001799374 5:174530075-174530097 ACCTACCATGTGCCCAGCTCAGG - Intergenic
1003135482 6:3431771-3431793 AACAAACGTGTCCACAGCTCAGG + Intronic
1003171987 6:3727196-3727218 GGCAAACATGTCCCCATCTCAGG + Intronic
1003848286 6:10196481-10196503 AGGACACATCTCCCCATCTCTGG - Intronic
1003977392 6:11356918-11356940 CCCACCCATGTCCTCAGCTGAGG - Intronic
1005417875 6:25620901-25620923 ACTAGCCCTGTCCCCAGCTCAGG + Intergenic
1006186255 6:32183185-32183207 GACACACATGTCCCCACCTGGGG + Exonic
1008878745 6:56358706-56358728 ACCAAACATGTCCCCAAGTCAGG + Intronic
1013367552 6:109447206-109447228 TGCACACAGGTCCCCAGCACCGG + Exonic
1015828577 6:137342971-137342993 TTCACACATTTGCCCAGCTCTGG + Intergenic
1018834258 6:167471303-167471325 ACCACACATTGCACCAACTCAGG + Intergenic
1023149872 7:37192205-37192227 ACCACACCTGGCCCTGGCTCTGG - Intronic
1028077569 7:86534654-86534676 TCCACACATGTCCCCAATTCTGG - Intergenic
1028444409 7:90903984-90904006 AGTACACATGTCCCCAGGGCTGG - Intronic
1030365429 7:108640525-108640547 CCCACCCCTGTCCCCAGCTTAGG + Intergenic
1032684271 7:134215424-134215446 ACCAGACTTCCCCCCAGCTCTGG + Intronic
1033034993 7:137866729-137866751 GACACACATGTTCCCAGCTGAGG - Intergenic
1034283498 7:149869406-149869428 CCCACACTTGGCCCCGGCTCTGG - Intergenic
1034384333 7:150726388-150726410 GCCACCCATGTCACCAGCTCTGG + Intronic
1034943620 7:155248173-155248195 GCCCCAGATGTCCTCAGCTCAGG + Intergenic
1037488711 8:19376022-19376044 ACCACACTTGTCCCTACCTTAGG + Intronic
1037872993 8:22517150-22517172 AGCACACATGTTCCCAGCTGAGG + Intronic
1038157320 8:25001950-25001972 CCCACACATCTCCACGGCTCTGG + Intergenic
1038464058 8:27743602-27743624 ACCACACTTGTCCCCTGATATGG - Intronic
1039431180 8:37526329-37526351 ACGACACATTTCCCCAGATGGGG - Intergenic
1047077093 8:121416119-121416141 ACAACAAATGTCCCTAGCTTGGG + Intergenic
1048842644 8:138579034-138579056 TCCGCACAGGGCCCCAGCTCAGG + Intergenic
1048855660 8:138684908-138684930 ACCACACTTGTCCTGAGCTGTGG + Intronic
1048857120 8:138694936-138694958 AGGGTACATGTCCCCAGCTCCGG + Intronic
1049499805 8:142955760-142955782 ACCCCACAAGTTCCCATCTCTGG - Intergenic
1057218570 9:93243369-93243391 ACCACACAAGTCCCCGTCCCTGG + Intronic
1060586884 9:124792222-124792244 AACACACATGTGCCTAGATCAGG - Intronic
1060586918 9:124792430-124792452 AACACACAGGTGCCCAGATCTGG - Intronic
1061232918 9:129325351-129325373 ACCACACATGGTCCCTGCCCTGG + Intergenic
1062569646 9:137179208-137179230 TCCTCACATGTCCCCCGCTGGGG + Intronic
1203746718 Un_GL000218v1:44296-44318 ACCATCCCTGTCCCCACCTCGGG + Intergenic
1187058011 X:15759225-15759247 ACCACCTATTTCCCCAGCTTTGG - Intronic
1188622289 X:32240853-32240875 ACATTTCATGTCCCCAGCTCAGG - Intronic
1189108067 X:38256804-38256826 GCCTCAGATGTCCCCAGGTCAGG - Intronic
1189366799 X:40395145-40395167 ACCAGAGATGTCCCCAGTTGAGG + Intergenic
1192310962 X:70013634-70013656 ACCAAGCAGGGCCCCAGCTCAGG + Intronic
1193797943 X:85899306-85899328 TCCACACATGTCCCCGGTTATGG - Intronic
1193901820 X:87189110-87189132 ACCACACTTGTCCACATCCCTGG - Intergenic
1199874430 X:151919787-151919809 ACCACTCATGCTCCCAGCCCTGG + Intronic
1201160047 Y:11159310-11159332 ACCATCCCTGTCCCCACCTCGGG + Intergenic