ID: 927555652

View in Genome Browser
Species Human (GRCh38)
Location 2:24029646-24029668
Sequence CAGTTTACCAAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927555652_927555656 3 Left 927555652 2:24029646-24029668 CCCAGCTCCATCTTGGTAAACTG 0: 1
1: 0
2: 0
3: 10
4: 166
Right 927555656 2:24029672-24029694 CAGACAGACAGGAGTCCCCAAGG 0: 1
1: 0
2: 6
3: 33
4: 231
927555652_927555655 -8 Left 927555652 2:24029646-24029668 CCCAGCTCCATCTTGGTAAACTG 0: 1
1: 0
2: 0
3: 10
4: 166
Right 927555655 2:24029661-24029683 GTAAACTGTAACAGACAGACAGG 0: 1
1: 0
2: 2
3: 8
4: 147
927555652_927555657 4 Left 927555652 2:24029646-24029668 CCCAGCTCCATCTTGGTAAACTG 0: 1
1: 0
2: 0
3: 10
4: 166
Right 927555657 2:24029673-24029695 AGACAGACAGGAGTCCCCAAGGG 0: 1
1: 0
2: 1
3: 21
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927555652 Original CRISPR CAGTTTACCAAGATGGAGCT GGG (reversed) Exonic
902224607 1:14988710-14988732 CAGTTTACAAGGATGGTCCTTGG + Intronic
905510315 1:38514255-38514277 CATTTTACCAGGAGGGAACTTGG + Intergenic
906138115 1:43514780-43514802 AATTTAACCAAGATGCAGCTGGG + Intergenic
906827585 1:48998231-48998253 CAGTTTATAAATGTGGAGCTGGG + Intronic
907786695 1:57619801-57619823 CATTTTCCCAGGATGAAGCTTGG - Intronic
907811012 1:57869922-57869944 AAGTTTTCCAAGGTGCAGCTTGG + Intronic
910537874 1:88320023-88320045 CAGATTCCCAATATGGATCTGGG - Intergenic
918225475 1:182477406-182477428 CAGTTGAGCAATGTGGAGCTGGG - Intronic
923126094 1:231035818-231035840 CAGTTTGCAAAAATGGAGCAAGG - Intronic
924241186 1:242042523-242042545 CAACTTACCAAGATTGAACTAGG + Intergenic
1064981017 10:21166717-21166739 CAGTAGGCCAGGATGGAGCTAGG + Intronic
1066242839 10:33554524-33554546 CAGTTTATCAAGAAGGTCCTTGG - Intergenic
1068668572 10:59701354-59701376 CGGTTTAGGAAGATGGATCTGGG - Intronic
1070428533 10:76313415-76313437 CAATTGCCCAAGATGGAGCCTGG + Intronic
1070445457 10:76496392-76496414 CAGTTTGCTGAGATGGAGCTGGG - Intronic
1072402213 10:95115797-95115819 CAGCCTACCAAGATGGAATTAGG - Intergenic
1073768770 10:106711899-106711921 CTGTTTTCCAAAATGTAGCTTGG + Intronic
1074281605 10:112056931-112056953 GACTTTACCTAGATGCAGCTTGG - Intergenic
1077596855 11:3540137-3540159 CAGCCTACCAAGATTGAACTAGG + Intergenic
1078033134 11:7773804-7773826 CAATTCACAAAGATGGAGATTGG - Intergenic
1079108298 11:17588361-17588383 CTCTTTACCAGGATGGAGCCTGG + Intronic
1080723596 11:34872859-34872881 CTGGTTACCAAGATGGATGTCGG - Intronic
1082027369 11:47582599-47582621 CAGGTTACAAAAATGAAGCTAGG - Intronic
1082852806 11:57780404-57780426 CACTTTATCAAGAAGGAGCATGG + Intronic
1083222504 11:61262276-61262298 CAGTTTCCCCAGGTGGAGGTAGG + Intronic
1084252773 11:67914091-67914113 CAGCCTACCAAGATTGAACTAGG + Intergenic
1084739023 11:71126566-71126588 CAGATTCCTCAGATGGAGCTGGG + Intronic
1084820090 11:71681933-71681955 CAGCCTACCAAGATTGAACTAGG - Intergenic
1088610511 11:111571972-111571994 CAGTTCAGCATGATTGAGCTGGG + Intergenic
1089159814 11:116428741-116428763 CAGTTTCTGAAGATGGAGCTCGG + Intergenic
1089944814 11:122458335-122458357 CAGTTTAGCAAACTGCAGCTTGG - Intergenic
1090788168 11:130068730-130068752 CAGTTTACCCACAGGGAACTGGG + Intergenic
1092423021 12:8348896-8348918 CAGCCTACCAAGATTGAACTAGG + Intergenic
1092948267 12:13476471-13476493 CCGTTTAGCAAGATGGAGGTGGG - Intergenic
1093222509 12:16439704-16439726 CAATTTTCCAACATGGACCTAGG + Intronic
1093307213 12:17536230-17536252 CAGTCTATCAAGATGGAACCAGG - Intergenic
1094815822 12:34182501-34182523 CAACTTACCAAGATTGAACTAGG - Intergenic
1095101329 12:38187996-38188018 CAACTTACCAAGATTGAACTAGG + Intergenic
1095426233 12:42077339-42077361 CAGCTTACCTAGATTGATCTAGG + Intergenic
1098817256 12:75182930-75182952 CAGTGTACTGAGATGGTGCTGGG + Intronic
1100779506 12:98009120-98009142 CAGTTCACCCAGATGCAGCATGG + Intergenic
1102216640 12:111166373-111166395 CAGCTTTCCAGAATGGAGCTAGG - Intronic
1102532839 12:113559312-113559334 CAGTTTCCGCAGATGTAGCTGGG - Intergenic
1103381731 12:120499201-120499223 CAGTTTCCCAAGATGGGTGTGGG - Intergenic
1108159834 13:47627645-47627667 CAGTCAACCAAAAAGGAGCTAGG + Intergenic
1109996772 13:70137945-70137967 CATTTTACCATGGTGGAGCAGGG + Intergenic
1111581458 13:90228901-90228923 CAATTTACCAAGAAGGAAATGGG - Intergenic
1113521625 13:110946079-110946101 CAGTTTCCCAGGAAGGCGCTGGG + Intergenic
1113740800 13:112711126-112711148 CACTTTACCACGAGGCAGCTGGG + Intronic
1114931604 14:27475455-27475477 CAGTTTACCAAGATAAATGTGGG + Intergenic
1115218998 14:31040736-31040758 CAGTTTACCAAAATGGCTTTAGG + Intronic
1116799994 14:49432981-49433003 CAACTTACCAAGATTGAGCCAGG + Intergenic
1118215716 14:63806591-63806613 CAATTTCCCAAGATTGAACTAGG - Intergenic
1118526197 14:66646770-66646792 CAGTTTTACAAGATGGTGTTTGG + Intronic
1202884703 14_KI270722v1_random:94187-94209 CAGTTTCCTAAGCTGGAGCGCGG + Intergenic
1126289358 15:47056223-47056245 CTGTTTACAGAGATGTAGCTAGG + Intergenic
1126975837 15:54179028-54179050 CAGTTTCCGAAGAGGAAGCTTGG + Intronic
1128192914 15:65720732-65720754 CAGTTAACAAGGATGAAGCTGGG - Intronic
1128609584 15:69063211-69063233 CATTTTACCAAGGGGGAGCTGGG - Intergenic
1129293257 15:74584695-74584717 CAGACAACCAAGATGTAGCTGGG - Intronic
1129347957 15:74936332-74936354 CAGTTTCCCAAGATGGACTTTGG + Intronic
1130692878 15:86100575-86100597 CAACTTACCAAGATTGAACTAGG - Intergenic
1133375229 16:5280645-5280667 CAGCCTACCAAGATTGAACTAGG - Intergenic
1134483648 16:14639552-14639574 CTGTCTACCAAAATGGAGGTGGG - Intronic
1139389110 16:66594560-66594582 CAGTTTAACAAGCAGGAACTTGG + Intergenic
1141254997 16:82392979-82393001 CACTTTACCAAAGAGGAGCTAGG - Intergenic
1142150411 16:88510159-88510181 CAGTTTACCCATATGGAGAAGGG - Intronic
1142405004 16:89883614-89883636 CAGGTAACCAAAATGGAACTCGG - Intronic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1145822988 17:27854518-27854540 CAGCAGAGCAAGATGGAGCTGGG - Intronic
1146472283 17:33134238-33134260 CAGTTGTCCAAGGTAGAGCTGGG + Intronic
1155706452 18:28821285-28821307 CAGCCTACCAAGATTGAGCCAGG - Intergenic
1158443188 18:57495575-57495597 CTGTTTAACAAAATGGTGCTGGG + Intergenic
1161625114 19:5322016-5322038 CAGTTTACCCAAATGGAAATGGG - Intronic
1166826065 19:45609986-45610008 CAGTCTCCCAAGAAGTAGCTGGG + Intronic
1167743831 19:51339857-51339879 CGGGTCACCAAGAAGGAGCTGGG - Intronic
1168343033 19:55636599-55636621 ATGTTGACCAGGATGGAGCTGGG + Intronic
1168396190 19:56050716-56050738 CAGTTTACCTAGATTGCCCTTGG - Intronic
927555652 2:24029646-24029668 CAGTTTACCAAGATGGAGCTGGG - Exonic
930513586 2:52377713-52377735 CAGTCTCCCAAGATTGAGCCAGG - Intergenic
930946818 2:57084989-57085011 GAGTCTACCATGATGGGGCTGGG - Intergenic
933377040 2:81492775-81492797 CAGTTTATGAGGATGCAGCTGGG + Intergenic
942000056 2:171637220-171637242 CATTTGAGCAGGATGGAGCTTGG - Intergenic
944870257 2:203904067-203904089 CAGTCTACCCAGATCCAGCTTGG + Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
948150891 2:235743921-235743943 CAGTTTTCCAAGATGGCTGTTGG + Intronic
948852482 2:240715222-240715244 CAGTGGACCAAGATGCAGCAAGG - Exonic
1168918276 20:1509657-1509679 CAGGTAATCAAGATGGAGGTTGG - Intergenic
1170445022 20:16417417-16417439 CAGTTTACCTAGCTGGATGTAGG - Intronic
1171054805 20:21895920-21895942 TAGCTTACCTGGATGGAGCTTGG - Intergenic
1171540318 20:25945874-25945896 CTGTTTACGGAGATGTAGCTAGG - Intergenic
1171777673 20:29384512-29384534 CAACTTACCAAGATTGAACTAGG - Intergenic
1171898853 20:30837997-30838019 CAACTTACCAAGATTGAACTAGG + Intergenic
1172991605 20:39040882-39040904 GAGTGGACCAGGATGGAGCTGGG + Intergenic
1180327593 22:11444809-11444831 CAGTTTCCTAAGCTGGAGCGCGG + Intergenic
1183669371 22:39263438-39263460 CAGGTTCCCAAGATGGCGCAGGG + Intergenic
1184431614 22:44444474-44444496 CAGGTGACCAAGGTGGAGCTGGG - Intergenic
1184981850 22:48100794-48100816 CCGGTTACCAAGAAGGAGCGTGG - Intergenic
951510182 3:23491780-23491802 CTGTTTACCAAACTGCAGCTAGG - Intronic
952273988 3:31859565-31859587 CATTTCACCAAGATGGAGATTGG - Intronic
953584727 3:44189277-44189299 AAGTAGACCAAAATGGAGCTTGG + Intergenic
956105821 3:65817587-65817609 CATTTTTCCAAGATGAAGCCAGG + Intronic
957066834 3:75530558-75530580 CAGCCTACCAAGATTGAACTAGG + Intergenic
957087533 3:75696236-75696258 CAACTTACCAAGATTGAACTAGG + Intergenic
958756610 3:98256998-98257020 CAATTTACCAAGATTGAACCAGG - Intergenic
961286313 3:125807492-125807514 CAGCCTACCAAGATTGAACTAGG - Intergenic
961900448 3:130205453-130205475 CAGCCTACCAAGATTGAACTAGG + Intergenic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
962546533 3:136441526-136441548 CAGTTTACCAGCATGTATCTGGG + Intronic
965500641 3:169452181-169452203 CAGTCTACCAAGCTGTAGTTGGG - Intronic
966128534 3:176608459-176608481 AAAATTCCCAAGATGGAGCTAGG + Intergenic
966328546 3:178784388-178784410 CAGTTTACAAAGAGGAAGCATGG - Intronic
967727464 3:192874985-192875007 CAGTTTACAAAGGTGTAGTTAGG - Intronic
968513398 4:1005032-1005054 CAGTTTACAGAGATGGAGGCAGG + Intergenic
969011430 4:4066630-4066652 CAGCCTACCAAGATTGAACTAGG + Intergenic
971243796 4:24911596-24911618 CAGTTTGAGAAGATGGAGCCAGG + Intronic
972107450 4:35507711-35507733 CAATTTACTAAGAAGAAGCTGGG + Intergenic
973766901 4:54170978-54171000 CTGTTTTCCAAGATGTTGCTTGG + Intronic
974017017 4:56656655-56656677 CATTTTACAGAGATGGAGATAGG + Intronic
979377023 4:119958774-119958796 CAGTTTAAAAAGGAGGAGCTGGG - Intergenic
979382410 4:120022655-120022677 CAGTTTAAAAAGGAGGAGCTGGG + Intergenic
983574718 4:169248710-169248732 CAGTTTCCCAATCTGGAACTTGG + Intronic
984269573 4:177534937-177534959 CTGTTTATAAAGATGCAGCTAGG - Intergenic
984512855 4:180699722-180699744 CAGTTTCCCAAGATTGGCCTAGG + Intergenic
985443447 4:190002564-190002586 CAGCTTACCCAGATTGAACTAGG - Intergenic
986172831 5:5327579-5327601 CAGTTTCCCAAGAGAGAGCAGGG - Intergenic
986301733 5:6482949-6482971 CAGTTTTCCCACTTGGAGCTGGG - Intronic
987112260 5:14699350-14699372 GAGTCTTGCAAGATGGAGCTGGG + Exonic
988080652 5:26410719-26410741 CAGTGTACCAAGCTGTACCTTGG - Intergenic
994954218 5:106506607-106506629 CAGCTTCCCAAGAAGTAGCTGGG - Intergenic
996321670 5:122223721-122223743 CAGCCTACCAAGATTGAGCCAGG + Intergenic
996490278 5:124086602-124086624 CAGTTTCCCAAGAAGGAGGAAGG - Intergenic
999354462 5:150911718-150911740 CAGTTTCTCAAAATGCAGCTTGG - Intergenic
1005031414 6:21512406-21512428 TGGTTTACAAAGACGGAGCTGGG + Intergenic
1005938395 6:30542475-30542497 CAGTTTATGCAAATGGAGCTTGG - Exonic
1006426892 6:33970094-33970116 TAGTTTCTCAAGATGGAACTTGG - Intergenic
1007635777 6:43298858-43298880 CAGTTTACCAATCTGTAGATGGG + Intronic
1009748399 6:67850454-67850476 CATCTTACCCAGATTGAGCTAGG + Intergenic
1010036385 6:71330471-71330493 CTGTTTATCAGTATGGAGCTCGG + Intergenic
1012418328 6:99034341-99034363 CAGTTTGCAAAGATGTGGCTCGG - Intergenic
1013318308 6:108962268-108962290 CAGGATGCCAAGATGGACCTAGG + Intronic
1015301003 6:131653164-131653186 CTGTTTTCCAAGCTGGAGCGCGG + Intronic
1017976775 6:159365200-159365222 CAGCTTTCCCAGATGCAGCTGGG + Intergenic
1018936692 6:168278512-168278534 CGGTTTTGCAAGATGGTGCTGGG - Intergenic
1021910934 7:25385545-25385567 CAGTTTACAAAAATGGAGAAGGG - Intergenic
1025291751 7:57732116-57732138 CTGTTTACGGAGATGTAGCTAGG - Intergenic
1028409210 7:90509636-90509658 CAGTTTACAAACATGAAGCCAGG + Intronic
1029070723 7:97894652-97894674 CAGCCTACCAAGATTGAACTAGG + Intergenic
1030407959 7:109138691-109138713 CAGCCTACCAAGATGGAACCAGG - Intergenic
1030477610 7:110056574-110056596 CAGTTTATCATGATGTTGCTAGG - Intergenic
1032387715 7:131536150-131536172 CAGTTTGCCATGATGTGGCTTGG - Intronic
1036247845 8:7135124-7135146 CAGCCTACCAAGATTGAACTAGG - Intergenic
1036252968 8:7179249-7179271 CAGCCTACCAAGATTGAACTAGG + Intergenic
1036364528 8:8108225-8108247 CAGCCTACCAAGATTGAACTAGG - Intergenic
1036894017 8:12616980-12617002 CAGCCTACCAAGATTGAACTAGG + Intergenic
1038012637 8:23487066-23487088 CAGCTCACCAAGATTCAGCTGGG - Intergenic
1039259864 8:35759753-35759775 CAGTTTAACAATATAGAGCCAGG + Intronic
1041212855 8:55570018-55570040 CAGTTTACAAATATGAATCTTGG - Intergenic
1041710229 8:60887670-60887692 TATTTTACCAAGAAGGAGATAGG - Intergenic
1042719872 8:71815792-71815814 CAGTTGACCAAGTTAGAGCTGGG + Intergenic
1044961951 8:97539878-97539900 CAGTTTGCCAGGATTGGGCTGGG - Intergenic
1049559666 8:143303278-143303300 AAGTTTACCATGTTGGGGCTGGG - Intergenic
1050526874 9:6553829-6553851 CACTTTCCCAAGATGGACATAGG + Intronic
1054164748 9:61713585-61713607 CTGTTTACGGAGATGTAGCTAGG + Intergenic
1056197636 9:84243931-84243953 CATTTTACAAAGAGGGAACTGGG - Intergenic
1057208965 9:93189289-93189311 GAGTTTCCCAAGATGGTGCTGGG + Intronic
1059612317 9:115911849-115911871 CAGAATATCAAAATGGAGCTTGG - Intergenic
1060104927 9:120867768-120867790 CAAGTTACCCAGCTGGAGCTTGG + Intronic
1186097994 X:6122915-6122937 CATTTTCCCAAAATGGATCTGGG + Intronic
1186850887 X:13579014-13579036 CAGCTTAGCAAGATGGGGCTTGG + Intronic
1192431168 X:71112753-71112775 AAATTTACCAAGATGGAGAGGGG + Intergenic
1193287815 X:79734132-79734154 CAACTTACCAAGATTGAACTTGG + Intergenic
1199194478 X:145011251-145011273 CAGTTTGACAAGATGGACGTTGG + Intergenic
1199445689 X:147918081-147918103 CAGTTTTCCAAGGTGGTGATAGG + Intronic
1201067687 Y:10114612-10114634 CAACTTACCAAGATTGAACTAGG + Intergenic
1201760621 Y:17533213-17533235 CAACTTACCAAGATTGAACTAGG - Intergenic
1201840932 Y:18372777-18372799 CAACTTACCAAGATTGAACTAGG + Intergenic