ID: 927558722

View in Genome Browser
Species Human (GRCh38)
Location 2:24053883-24053905
Sequence CTTCCTGCAGGGAGACATGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 321}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927558722_927558727 -6 Left 927558722 2:24053883-24053905 CCCTCATGTCTCCCTGCAGGAAG 0: 1
1: 0
2: 4
3: 41
4: 321
Right 927558727 2:24053900-24053922 AGGAAGGACATTCCCCAAGAAGG 0: 1
1: 0
2: 1
3: 25
4: 221
927558722_927558734 22 Left 927558722 2:24053883-24053905 CCCTCATGTCTCCCTGCAGGAAG 0: 1
1: 0
2: 4
3: 41
4: 321
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558722_927558728 -5 Left 927558722 2:24053883-24053905 CCCTCATGTCTCCCTGCAGGAAG 0: 1
1: 0
2: 4
3: 41
4: 321
Right 927558728 2:24053901-24053923 GGAAGGACATTCCCCAAGAAGGG 0: 1
1: 0
2: 1
3: 19
4: 203
927558722_927558732 9 Left 927558722 2:24053883-24053905 CCCTCATGTCTCCCTGCAGGAAG 0: 1
1: 0
2: 4
3: 41
4: 321
Right 927558732 2:24053915-24053937 CAAGAAGGGCCAAACGTGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927558722 Original CRISPR CTTCCTGCAGGGAGACATGA GGG (reversed) Exonic
900197874 1:1386265-1386287 CTTCCTGCAGGGCCATAGGAGGG - Intronic
900327958 1:2119667-2119689 CGTCCTGCAGGAAGACTAGAAGG - Intronic
900435474 1:2628857-2628879 CATCCTGCGGAGAGACCTGAGGG - Intronic
900457366 1:2783772-2783794 CTTCCTGCAGGAAGACGGCATGG + Exonic
900938066 1:5779666-5779688 AATCCTGCAGGGAGACCTGAGGG + Intergenic
901473005 1:9470688-9470710 CATCCTGCCAGGAGAAATGAAGG + Intergenic
901775894 1:11560265-11560287 CTGCCTGCAGGGATTCAAGATGG - Intergenic
902676239 1:18010451-18010473 CTTCCTTCAGGGTGGCACGATGG + Intergenic
902715029 1:18266840-18266862 TGTCCTGCAGGGAGACAAGAGGG + Intronic
902722380 1:18312661-18312683 CTTATTGGAGGGAGACAGGAGGG - Intronic
903027102 1:20437169-20437191 CTTCCTGCAGGGCCCCAGGATGG - Intergenic
903278892 1:22238929-22238951 CAGCCTGAAGGGAGACAAGAAGG + Intergenic
903350755 1:22715239-22715261 CTTCCTGGAGGGAGATACCAAGG + Intronic
903812363 1:26041802-26041824 CTGGCTGCAGGAAGACAGGAAGG + Exonic
904978781 1:34479342-34479364 TTTCCTGAAGGGAGAAAAGAGGG + Intergenic
905499998 1:38428702-38428724 GCTGCTGCACGGAGACATGATGG - Intergenic
905795149 1:40811779-40811801 CAACTTGCAGGCAGACATGATGG + Intronic
905969635 1:42131731-42131753 CTTCAGGCAGGGAAACAGGATGG + Intergenic
907983521 1:59508011-59508033 TTTCCTGTAGGGAGCCCTGAGGG - Intronic
908843166 1:68298613-68298635 TTTCATCCAGGGAGAAATGATGG + Intergenic
909031679 1:70548753-70548775 CTTCCTGCAAGGAGAGGGGAAGG + Intergenic
909788054 1:79640810-79640832 GCTGCTGCATGGAGACATGAGGG + Intergenic
910670676 1:89769652-89769674 CTGCCTGCAGTGAGAGAGGAAGG - Intronic
910895928 1:92069296-92069318 CATCCTGCATGGTGACATGAAGG - Intergenic
913066488 1:115260707-115260729 ATACCTGGAGGGGGACATGAGGG + Intergenic
914045917 1:144092179-144092201 CTTCCTACAGGGAGAAAGGAAGG - Intergenic
914132193 1:144868508-144868530 CTTCCTACAGGGAGAAAGGAAGG + Intergenic
916446704 1:164879382-164879404 CTACCTGCAAGTAGGCATGAAGG + Intronic
918077907 1:181184273-181184295 CTTCCACCAGGGAGCCATAAGGG + Intergenic
920256900 1:204661672-204661694 CATCCTGCTGGGAGCCATGAGGG + Intronic
920427097 1:205887176-205887198 GCTGCTGCATGGAGACATGATGG + Intergenic
920530665 1:206699737-206699759 CTGCATGCAGGGAGACAGGGAGG + Intronic
920829620 1:209452550-209452572 CCTGCTGCACGCAGACATGAGGG - Intergenic
922998434 1:229985329-229985351 CTGCCTGAAGGGACACATGGAGG - Intergenic
924066559 1:240229173-240229195 CTTCCTCCATGAAGACTTGATGG - Intronic
924866664 1:247990227-247990249 CTTCCTGAAGGGAGACACAAGGG - Intronic
924869142 1:248021908-248021930 CTTCCTGAAGGGAGACACAAGGG - Intronic
924870455 1:248038228-248038250 CATCCTGAAGGGAGACAAAAGGG - Intronic
924872185 1:248060642-248060664 TTTCCTGAAGGGAGACACAAGGG - Intronic
1063003016 10:1942433-1942455 ATACCTCCAGGGAGAGATGAGGG + Intergenic
1063363404 10:5474952-5474974 GCTGCTGCACGGAGACATGATGG - Intergenic
1066354431 10:34668011-34668033 CTTCCTGCATGGAGTGAGGATGG + Intronic
1066455086 10:35565562-35565584 CTACCTCCAGGGAGAAAAGAAGG - Intronic
1067091990 10:43271840-43271862 CTGCCAGGTGGGAGACATGAAGG - Intergenic
1067364176 10:45609771-45609793 CTTCCTTCAGGAAGTAATGATGG + Intergenic
1067693336 10:48518535-48518557 CTTCAGGCAGAGAGAAATGAGGG + Intronic
1069661092 10:70123955-70123977 CTTCATGCTGGTGGACATGAAGG - Exonic
1069919826 10:71809810-71809832 CTTCCTGCAGGGAGCATGGACGG + Exonic
1070106558 10:73438081-73438103 CTTCCTGGATGGAGGCTTGAGGG - Exonic
1071614230 10:87060169-87060191 CTTCCTGGAGAGAAACATTATGG - Exonic
1071697636 10:87894054-87894076 TTTCCTGCAGAAAGACTTGAAGG + Exonic
1072016698 10:91354331-91354353 ATGCCTGCAGAGAGACATAAGGG - Intergenic
1072176594 10:92929813-92929835 ATTACTGAAGTGAGACATGAGGG + Intronic
1072550774 10:96475677-96475699 GTCCCTGGAGGGAGACATGGGGG - Intronic
1072657835 10:97342807-97342829 ATTCCTGCAGGTAGACACCAAGG + Intergenic
1073347493 10:102794830-102794852 GTTCCTTCAGAGAGACATGCTGG - Intronic
1073709269 10:106019707-106019729 GCTGCTGCAGGCAGACATGAGGG + Intergenic
1073761435 10:106632743-106632765 ATTATTGCAGGGTGACATGAAGG + Intronic
1075400051 10:122154388-122154410 ATTACTCCAGGAAGACATGAAGG - Intronic
1075611116 10:123855514-123855536 CTTCCTGCCAGGAGAAATGTGGG + Intronic
1076720179 10:132389030-132389052 CTTCCTTGAGGGAGCCAGGAGGG - Intergenic
1077541472 11:3148428-3148450 CTTCCTGCTGGCAGCCCTGAAGG + Intronic
1080662303 11:34307072-34307094 ATTCATTCAGGGAGACATGCAGG - Intronic
1081229361 11:40565288-40565310 TTTCATGAAGGGAGACCTGAGGG - Intronic
1081330192 11:41792121-41792143 CTGACAGCAGGGAGAAATGAAGG + Intergenic
1083848518 11:65351664-65351686 CTTCCTGCAGAGAGGCAAAATGG - Exonic
1084091404 11:66881477-66881499 CTTCCAGAAGGGAGTCAGGAAGG + Intronic
1084719242 11:70893533-70893555 TTTCCCGCAGAGAGAGATGAAGG - Intronic
1085311268 11:75518303-75518325 CTTCCTGCCTGGAGAGATGAGGG - Intronic
1085692147 11:78672668-78672690 CTTTCAGCAGGGAGTCAAGAAGG - Intronic
1087891571 11:103542952-103542974 CTCCCTCCAGGGAGCTATGATGG + Intergenic
1088125122 11:106415156-106415178 GTTTCTGCAGGGATAGATGAAGG + Intergenic
1089130396 11:116207826-116207848 CATCCTGCAGAGAGAGAGGACGG - Intergenic
1089220878 11:116870398-116870420 CTGCCTGAAGAGAGACAGGAAGG + Exonic
1089760074 11:120716742-120716764 CTTCCAGCAGTGAGAGAAGAAGG + Intronic
1089953583 11:122550958-122550980 GGTGCTGCACGGAGACATGATGG - Intergenic
1090358535 11:126156889-126156911 TTCCCTGCGGGGAGACAAGAAGG + Intergenic
1090939471 11:131374355-131374377 CTTCATGCAGCGAGACCTGCCGG - Intronic
1091356366 11:134940959-134940981 CTCCCTGCTGGGGGCCATGAAGG - Intergenic
1092042376 12:5395915-5395937 CTTCCTGAAGGGCGACATCTGGG - Intergenic
1094026079 12:25960375-25960397 CTTTCTGCAGGGAGAGGTGCAGG + Intronic
1096120762 12:49088306-49088328 CTCCCAGGAGGGAGAGATGATGG - Intergenic
1096436345 12:51593137-51593159 CCTCTTTCAGGGAGAAATGAAGG - Intronic
1096525369 12:52207142-52207164 CTTCCTGCAGGGAGCCACCTGGG - Intergenic
1096673643 12:53214846-53214868 GCTCCTGCAGGGTGACAGGAAGG - Intronic
1097189514 12:57212771-57212793 CTGCCTTCAGGGAGACAGGCAGG + Exonic
1097321766 12:58233540-58233562 CTTTCTGCAGGGAAGTATGAAGG + Intergenic
1098439661 12:70504461-70504483 CTCCCTGCAGGGAGGCCTGCAGG - Intergenic
1099367461 12:81785841-81785863 CTTCCTGCAGTGAAATATGTGGG + Intergenic
1100173788 12:92006992-92007014 CTTCCTCCAGGGAGCCTTCATGG - Intronic
1100450994 12:94706310-94706332 CTTCCTTCAGGGAGGGGTGAAGG - Intergenic
1102537543 12:113592451-113592473 ATGGGTGCAGGGAGACATGAGGG + Intergenic
1102789791 12:115635690-115635712 CATCCTGTGGCGAGACATGAAGG + Intergenic
1103905718 12:124326367-124326389 CCACCTGCAGGGGGACAAGATGG + Exonic
1105926966 13:25017549-25017571 CTTCCTACAGGGAGAAAGGAAGG + Intergenic
1108947683 13:56044149-56044171 GCTGCTGCATGGAGACATGATGG - Intergenic
1109810200 13:67503438-67503460 CTTCCTGAAGGCAGACATTCAGG - Intergenic
1109979077 13:69882483-69882505 CTCCCTGCAGGAAAACATAATGG - Exonic
1112538091 13:100280914-100280936 CTCACTGCAATGAGACATGATGG + Intronic
1113569667 13:111344930-111344952 CTTCCTGCAGGGGGAGGTTATGG + Intergenic
1113929041 13:113956836-113956858 CATCCTGCAGGGCGAGAGGAGGG + Intergenic
1116050325 14:39795057-39795079 CTTTCTAAGGGGAGACATGATGG + Intergenic
1116760831 14:49011551-49011573 CTTCCTGCAGGTAGGCAACAAGG - Intergenic
1116797092 14:49402993-49403015 CTTTCTGCAGGGTGAATTGAGGG - Intergenic
1117720612 14:58625413-58625435 CTCCGTCCTGGGAGACATGAAGG - Intergenic
1117725174 14:58666033-58666055 CATCCTGAAGGGAAACATGAAGG + Intergenic
1119731909 14:76956527-76956549 CTTCCTGCAGGGAGGCGGGGTGG - Intergenic
1120169643 14:81236076-81236098 CTGCTTGCAGGGAGATGTGAAGG + Intergenic
1120251142 14:82062956-82062978 GCTGCTGCACGGAGACATGATGG + Intergenic
1120623108 14:86790715-86790737 TTTTCTGGAGGGAGAGATGAGGG - Intergenic
1120659683 14:87236741-87236763 GCTGCTGCACGGAGACATGATGG + Intergenic
1121975290 14:98397785-98397807 CTTGGTGCAGGTAGACAGGAAGG - Intergenic
1122045784 14:99022245-99022267 CTTCCACCAGGGCGGCATGATGG - Intergenic
1123132925 14:106001473-106001495 CTCACCGCAGGGAGACAGGAGGG - Intergenic
1123137797 14:106045540-106045562 TTCCCTGCAGGAAGACAAGAGGG - Intergenic
1123142593 14:106095230-106095252 TTCCCTGCAGGGAAACAGGAGGG - Intergenic
1123147063 14:106142225-106142247 CTCCCTGCAGGGAGACAGGAGGG - Intergenic
1123154454 14:106210875-106210897 GTCCCTGCAGGAAGACAGGAGGG - Intergenic
1123175855 14:106417957-106417979 GTCCCTGCAGGGAGACAGGAGGG - Intergenic
1123181012 14:106470202-106470224 CTTGCTGCAGGAAGACAGGAGGG - Intergenic
1123218211 14:106831670-106831692 CTCCCTGCAGGGAGACAGGAGGG - Intergenic
1202945894 14_KI270726v1_random:26577-26599 CTCCCTGCAGGAAGACAGGAGGG + Intergenic
1123582951 15:21731919-21731941 CTCACTGCAGGGAGACAGGAGGG - Intergenic
1123619601 15:22174515-22174537 CTCACTGCAGGGAGACAGGAGGG - Intergenic
1125886563 15:43234172-43234194 CTTCCGGTGGGGAAACATGAAGG - Intronic
1126583022 15:50258436-50258458 CTCCCTGCTAGGAGACATGCTGG - Exonic
1127686890 15:61354705-61354727 CTTCCTGCAGTGAGAAAGGAGGG - Intergenic
1129187581 15:73919601-73919623 CCTCCTACAGGGACACAAGAAGG + Intergenic
1129323563 15:74787899-74787921 CGTGCTGCAGGGAGACAGGAGGG + Intronic
1129772504 15:78211800-78211822 CTTCCTGCAGGAGGAGTTGAAGG - Intronic
1131114320 15:89784703-89784725 AGTCCTGCAGGCAGACATGGAGG + Intergenic
1131381498 15:91967961-91967983 CTTCCTGCAGAGATGCAAGATGG + Intronic
1131844224 15:96471660-96471682 CTTCCAGCAGAGAGACTAGAAGG - Intergenic
1132545288 16:530238-530260 CATCCAGCAGGGAGACAGGGCGG - Intronic
1134448175 16:14346412-14346434 CTTACAGCAGGGAGGCAAGAGGG + Intergenic
1135865846 16:26101145-26101167 CCTGCTGAAGGGAGAAATGATGG - Intronic
1136691884 16:32038874-32038896 CTCCCTGCAGGGGGACAGGAGGG + Intergenic
1136792472 16:32982436-32982458 CTCCCTGCAGGGGGACAGGAGGG + Intergenic
1136877345 16:33871471-33871493 CTCCCTGCAGGGGGACAGGAGGG - Intergenic
1137562825 16:49513887-49513909 CTTCCTGCAGGCAGATAGGCAGG + Intronic
1137881329 16:52051566-52051588 CTTCCTTCAGAAAGACATTATGG - Intronic
1138535072 16:57655545-57655567 CTTTCTCCTGGGAGGCATGAGGG - Intronic
1139452967 16:67046651-67046673 CTACCTGCAAGGGGGCATGAGGG - Intronic
1140934352 16:79656801-79656823 TTTTATGCAGGGAGGCATGAGGG + Intergenic
1142122951 16:88396334-88396356 CCTCCTGCAGGGAGGCCTGGAGG + Intergenic
1142289711 16:89187981-89188003 GTTCCTGCTGGGAGGCAGGAGGG + Intronic
1203094678 16_KI270728v1_random:1243901-1243923 CTCCCTGCAGGGGGACAGGAGGG + Intergenic
1143859392 17:9877377-9877399 CCTTCTGGATGGAGACATGAAGG - Intronic
1147166663 17:38596991-38597013 CTTCCTGCCGGGAGACACTGTGG + Intronic
1148006790 17:44438771-44438793 CTTCTAGCAGGCAGACAGGATGG + Intronic
1148342219 17:46880088-46880110 CTGCCTGCAGGAGGACATGCAGG - Intronic
1149014570 17:51892775-51892797 CTTCCTGCTGGTGGGCATGATGG + Intronic
1149621377 17:58047806-58047828 ATTCCTCCAGGGAGCCATCATGG + Intergenic
1151636341 17:75351104-75351126 GTTACTGCAGGGAGCCAGGAGGG + Intronic
1151846544 17:76659892-76659914 CTTCCTGCAGGGATGGATGCAGG - Intergenic
1152572380 17:81126548-81126570 CTTTCTGCAGGGGGACCTCAAGG - Exonic
1152888571 17:82866924-82866946 CTTCCTGCTGGGAAAACTGATGG - Intronic
1154498279 18:14978341-14978363 CTCCCTGCTGGGGGCCATGAAGG + Intergenic
1157350607 18:46881599-46881621 CTTCTTGTAGTGAGACTTGAGGG - Intronic
1157479028 18:48040937-48040959 CTTGCTGCAGGCAGCCAGGACGG + Exonic
1158195531 18:54881228-54881250 CGACTTGCAGGGAGACAGGAGGG + Intronic
1159939263 18:74394033-74394055 CTTCCTTGAGGGGGAAATGAGGG + Intergenic
1161097607 19:2401965-2401987 TTTGTTGCAGGGAGACATAAGGG + Exonic
1161887941 19:7011533-7011555 CTTCCTCCAAGGTGACAAGATGG - Intergenic
1162259275 19:9519161-9519183 CTTCATGCTGGGAGCCATGGTGG - Intergenic
1162421202 19:10567069-10567091 CATCCTGCAGGGCCACATGGTGG - Exonic
1162670730 19:12255712-12255734 CTACCTGCAGGGCCACAAGAAGG + Intronic
1163169159 19:15518838-15518860 CTTCTTGCAGGGAGAAAGGATGG + Intronic
1163468204 19:17481912-17481934 GTCCCTGCAGGGAGACCTGGTGG + Intronic
1163535841 19:17875942-17875964 CATGCTGCAGGGCGGCATGAAGG + Exonic
1164156570 19:22601034-22601056 CTACCTGCAGGAAGACCTGCAGG - Intergenic
1164161539 19:22628435-22628457 CATCCTGCAGATGGACATGATGG + Intergenic
1164862781 19:31575790-31575812 CTTTCTGCCGGGAGACACAAAGG - Intergenic
1165835580 19:38753241-38753263 CGCGCTGCACGGAGACATGAGGG - Intronic
1166217950 19:41348453-41348475 TTTCTAGCAGGGAGAAATGAAGG + Exonic
1168134295 19:54339808-54339830 CTTCCTTGTGGGAGCCATGAGGG + Intergenic
1168217903 19:54939828-54939850 CTTCCTGGAGGAGGACAGGAGGG - Exonic
1168224215 19:54982772-54982794 CTTCCTGGAGGAGGACAGGAGGG + Exonic
1202685477 1_KI270712v1_random:45590-45612 CTTCCTACAGGAAGAAAGGAAGG - Intergenic
925554978 2:5120980-5121002 CTCCCTGGAGGGAGAGAGGATGG - Intergenic
927000982 2:18793913-18793935 CTTCCTGCAGTGGTAGATGAGGG - Intergenic
927558722 2:24053883-24053905 CTTCCTGCAGGGAGACATGAGGG - Exonic
928960922 2:36925175-36925197 CTTCCTGCAGGGAGAAAGGAAGG - Exonic
930098786 2:47587349-47587371 GCTACTGCATGGAGACATGATGG + Intergenic
930859428 2:56054495-56054517 CTACTTGCAGGCTGACATGAAGG + Intergenic
931380053 2:61744387-61744409 CAGCCTGCAGTGAGCCATGATGG + Intergenic
932284227 2:70518950-70518972 CTTCCTGCATGAAGGGATGAAGG + Intronic
933428175 2:82139962-82139984 CATCCTGCAGAGAGACTTGTTGG + Intergenic
934246249 2:90309241-90309263 CTTCCTACAGGGAGAAAGGAAGG + Intergenic
934513172 2:94964478-94964500 CTCCCTGCAGGGAGACAGGAGGG - Intergenic
934573016 2:95383983-95384005 CATCCTGCATGGAGAGAGGAAGG - Exonic
934942879 2:98515112-98515134 CTTCCTGCAGACAGACAGGAAGG - Intronic
935505149 2:103891232-103891254 CTTCCTTCAGGGAAGCATGTGGG + Intergenic
935934989 2:108172192-108172214 CTTCCTACAAGGAGACATACAGG + Intergenic
937017214 2:118617017-118617039 CTTCCTCCAGGGAGTCCTCAAGG + Intergenic
937207396 2:120245581-120245603 GTTCCTGCAGGGCGCCAGGAAGG - Intronic
937486816 2:122324050-122324072 CTTTCTGCGGGCATACATGAGGG - Intergenic
937768811 2:125694923-125694945 CTGGCTGCAGGGAGAGAAGAAGG + Intergenic
938588905 2:132718664-132718686 CTCCCTGCAGGTAGCCATGCTGG + Intronic
938630369 2:133160197-133160219 CTGCCTTCAGGGAGCCCTGAAGG - Intronic
938898698 2:135778515-135778537 CTTCCTGAAGGTATATATGAGGG + Intronic
939216270 2:139242623-139242645 CTTCCTGCAGAGAGAGCTCAGGG - Intergenic
939448637 2:142342265-142342287 CTGCCTGCAAGAAGACAGGAAGG - Intergenic
942730042 2:179053630-179053652 GCTGCTGCACGGAGACATGATGG + Intergenic
942930701 2:181488992-181489014 CCTCATGCAGGCAGACATGGTGG - Intronic
943564608 2:189503078-189503100 CTTCCTTCAGGGAGACCTGGTGG + Intergenic
945361855 2:208902860-208902882 GCTGCTGCACGGAGACATGATGG - Intergenic
945424486 2:209683110-209683132 CTTCCTGTAGGGTAATATGATGG + Intronic
946886714 2:224228921-224228943 GCTGCTGCACGGAGACATGAGGG - Intergenic
947190551 2:227500427-227500449 CTCCCTGCAGGCAGACAAGCTGG - Intronic
947728814 2:232417074-232417096 CTGCCTGCAGGGGGACATTTGGG + Intergenic
1168882053 20:1215468-1215490 CATCCTGCACTGTGACATGAAGG - Intergenic
1169414713 20:5405970-5405992 CATCCTGCAGGGAGACACTGAGG + Intergenic
1169830536 20:9820440-9820462 CCTCCTCCAAGGAGAAATGAAGG + Intronic
1170325240 20:15149695-15149717 GCTGCTGCACGGAGACATGATGG + Intronic
1170903059 20:20484895-20484917 CTTCATGGAGGAAGAGATGAAGG + Intronic
1171491015 20:25517179-25517201 CATCCTGCTGTGAGACACGAGGG + Intronic
1172165890 20:32898950-32898972 CTTCCTGAAGGGTTGCATGAGGG + Intronic
1172298232 20:33829181-33829203 CTTCTTGCTGGGAGAGAGGAGGG + Intronic
1173471339 20:43325882-43325904 CTTCCTGCCAAGAGTCATGAGGG + Intergenic
1173646442 20:44636111-44636133 ATTCCCACAGGGAGACAGGAAGG + Intronic
1173763530 20:45586075-45586097 GCTGCTGCACGGAGACATGATGG + Intergenic
1176154357 20:63610785-63610807 CTTGATGGAGGGAGCCATGAAGG - Intronic
1176685866 21:9848036-9848058 ACTGCTGCACGGAGACATGATGG - Intergenic
1180701339 22:17782992-17783014 CTTCCTGGAGAGAGGGATGAAGG + Intergenic
1181365171 22:22370993-22371015 CTGCCTGCAGGGACCCAGGATGG + Intergenic
1181912330 22:26248688-26248710 CTTCCAGCAAGGAGACAGAATGG + Intronic
1183246039 22:36694147-36694169 CTTGCTGCAGGGAGAAACGTAGG - Intronic
1184499950 22:44865558-44865580 CTTGCTGCAGGGAGAAATGGGGG + Intergenic
1184668702 22:46001797-46001819 CTTCCCCCAGGGAGCCAAGAGGG + Intergenic
1184721792 22:46318905-46318927 CTTCCTGCCGGGAGGTATGAGGG - Intronic
950202223 3:11052962-11052984 CTTCCTCCAGGAAGACATCTTGG + Intergenic
950561920 3:13735839-13735861 GTCCCTGCTGGGAGACATGGGGG + Intergenic
953641165 3:44709686-44709708 CTTCTTGAAGGGAAACCTGAAGG - Intergenic
953880678 3:46689837-46689859 ATCCCTGAAGGGAGACTTGATGG - Intronic
954239807 3:49284626-49284648 CTTACTGCATTAAGACATGAAGG + Intronic
954381665 3:50222076-50222098 CATCCTGCAGGCAGACCTGGGGG + Intergenic
954763632 3:52895809-52895831 CTTCCTTCAGAGAGAAAGGAAGG + Intronic
954984590 3:54778405-54778427 CTTCCTGCAGAGAGAAAAGCAGG - Intronic
955558516 3:60163590-60163612 CTTCCTCCAGGGAGGTCTGAAGG - Intronic
957237699 3:77615730-77615752 CTACCTACTGGGAGACATGTTGG + Intronic
957734674 3:84190036-84190058 GCTGCTGCAGGGAGACATGATGG + Intergenic
957793595 3:84972062-84972084 CTTACAGCAGTAAGACATGATGG + Intronic
958173411 3:89965152-89965174 GTTTCTTCAGGGAGACAAGAAGG - Intergenic
958815938 3:98915642-98915664 CAGACTGCAGGGATACATGATGG - Intergenic
960704994 3:120473348-120473370 TTTCTTGCAGGGAGTGATGAAGG + Intergenic
961431955 3:126889867-126889889 GTTCCAGCAGGGAGATGTGAGGG + Intronic
961702217 3:128754048-128754070 CTTCATGAAGGAAGTCATGAAGG + Intronic
962660884 3:137599319-137599341 GCTGCTGCACGGAGACATGATGG - Intergenic
962974401 3:140433527-140433549 CTCCCTGCAGGGAGACATTCTGG - Intronic
963301026 3:143597364-143597386 CTTCTTGCAGACAGACAGGAGGG + Intronic
964068109 3:152601079-152601101 GCTGCTGCATGGAGACATGATGG - Intergenic
964826095 3:160829656-160829678 CATCCTGCAGGTAGACAGGCTGG + Intronic
965279378 3:166728288-166728310 ATTAGTGCAGGGAGACATAAAGG - Intergenic
965286521 3:166826178-166826200 GCCGCTGCAGGGAGACATGATGG + Intergenic
965335370 3:167426601-167426623 GCTGCTGCACGGAGACATGATGG - Intergenic
966067075 3:175831518-175831540 GCTGCTGCACGGAGACATGATGG - Intergenic
967422232 3:189286351-189286373 CTTCTGGCATGGAGACAGGAAGG - Intronic
968503577 4:961917-961939 GTTCCTGCTGGGGGACCTGAGGG + Intronic
968632907 4:1661407-1661429 CTTCCTGCAGGGAGGCGGGTGGG - Intronic
968779578 4:2570255-2570277 AACCCTGCAGGGAGACATAAGGG - Intronic
973220746 4:47723354-47723376 TTTCATGCATGGAGACCTGAGGG - Intronic
974904049 4:68034615-68034637 GCTGCTGCATGGAGACATGATGG - Intergenic
975647662 4:76561489-76561511 CTGCCTGGAGGTAGAAATGAGGG + Intronic
978219350 4:106252220-106252242 AATGCTGGAGGGAGACATGAAGG - Intronic
978438830 4:108712781-108712803 GCTGCTGCACGGAGACATGATGG - Intergenic
981152486 4:141395536-141395558 CTTCCAGCAGGGAGAGAGGCAGG - Intergenic
982144475 4:152368875-152368897 CTTCATGTAGGGAGACATAATGG + Intronic
983888556 4:173007499-173007521 CTTCAAGCAGGAAGATATGATGG + Intronic
984098797 4:175463265-175463287 GCTGCTGCACGGAGACATGATGG + Intergenic
985850998 5:2389124-2389146 GTCCCTCCAGAGAGACATGAGGG + Intergenic
986227000 5:5825077-5825099 CTTCCTACAAGGAGAGAAGAGGG + Intergenic
986558975 5:9041627-9041649 CTCCATGCAGGGAGAGGTGAGGG + Exonic
986690110 5:10307236-10307258 CTTCCTGCAGTGAGACATTCTGG - Intronic
986737907 5:10681541-10681563 CTTCCTGCAGGGACACTGGTGGG - Intronic
986737923 5:10681600-10681622 CTTCCTGCAGGGACACTGGTGGG - Intronic
988263925 5:28927040-28927062 CTTCCTACAGGGAGAAAGGAAGG + Intergenic
988605233 5:32673472-32673494 CTTCCTGCAGGGAGGTGTGGAGG - Intergenic
994775889 5:104035240-104035262 GCTGCTGCACGGAGACATGAGGG - Intergenic
996622048 5:125517653-125517675 CTTCCTGCAGTGAGTGTTGAGGG - Intergenic
997610349 5:135211549-135211571 CTGTCTCCAGGGAGACAGGAGGG + Intronic
998348644 5:141486360-141486382 GTTCCTGAAGGCAGACTTGAGGG - Exonic
999668563 5:153937707-153937729 GTTCCTGCAGTGAGACCTGCAGG - Intergenic
1000142023 5:158414595-158414617 CTGCCCACAGGGAGTCATGAGGG - Intergenic
1000384977 5:160666748-160666770 CTCCCTGGAGGGAGACATCTTGG - Intronic
1001649019 5:173302197-173302219 AGCCCTGCAGGGAGACCTGAAGG - Intergenic
1002061139 5:176626758-176626780 CTTCCTGCAGGGAGAAAAAGCGG + Exonic
1003028481 6:2579666-2579688 CTTCCTGCAGAGAGACATTCTGG + Intergenic
1004837249 6:19542745-19542767 GCTGCTGCACGGAGACATGATGG - Intergenic
1005061107 6:21777823-21777845 CTTCCTACAGAGCCACATGACGG - Intergenic
1006074943 6:31526190-31526212 CTTCCTGCAGGGTGTTCTGAAGG - Intergenic
1007180817 6:39927863-39927885 CGTCCTGCAGAGAGAAAGGAGGG + Intronic
1007835085 6:44667962-44667984 CCACCTGCAGGGAGAAAAGAGGG - Intergenic
1008558889 6:52704148-52704170 CTTCCTGCAGGAAGAAAAGCTGG - Intergenic
1009662044 6:66626209-66626231 CTAAATGCAGGGAGACATTAAGG - Intergenic
1011179285 6:84601531-84601553 CTTCCTGCAGAGCCACATGGCGG - Intergenic
1014179339 6:118367652-118367674 CTTCATGCAGTGAGACACAAAGG + Intergenic
1014707896 6:124770488-124770510 CTTCCTGGAGAGAGATATTAAGG + Intronic
1016907155 6:149162674-149162696 ATTCCTGGAGGTAGAAATGATGG + Intergenic
1017523695 6:155224411-155224433 CTTCATCCAGGTACACATGATGG + Intronic
1018067443 6:160133847-160133869 CTTCCCGCGGGGAGACAAGCTGG + Intronic
1019398024 7:833982-834004 CTTCCTTCAGTGAGACCTGTGGG + Intronic
1019398437 7:836229-836251 CCTCCTGCAGAGAGAGAGGAGGG + Intronic
1019484816 7:1284659-1284681 CTGCCTGCAGGGAGCCCTGGCGG - Intergenic
1020138350 7:5598895-5598917 CTGCCTGTAGGTAGACATGCAGG + Intronic
1021294341 7:18885948-18885970 CTTCCTGCAAGGACAGAGGAAGG + Intronic
1021624084 7:22575744-22575766 CTACCTGCAGGAGGAGATGAAGG - Intronic
1021841694 7:24726344-24726366 CCTCCTGCAGAGACACAGGAGGG + Intronic
1024258644 7:47558135-47558157 CTTCCTGCAGGCAAGAATGAGGG + Intronic
1024360138 7:48459633-48459655 CTTCCTACAGGGAGACTTCCTGG + Intronic
1024612826 7:51081750-51081772 CTTCCTGCAGGAAAAAGTGAGGG - Intronic
1024951245 7:54862919-54862941 CTTCCTGAAGGCAGACAGAAGGG + Intergenic
1025831799 7:65058211-65058233 CTCACTGGATGGAGACATGAAGG + Intergenic
1025919487 7:65897653-65897675 CTCACTGGATGGAGACATGAGGG + Intronic
1026911580 7:74094486-74094508 CTTCCTGCAGGCAGGAGTGAGGG + Intronic
1027651965 7:80879285-80879307 CTTCCTGGAGGTAGACAAGAGGG + Intronic
1029435953 7:100564155-100564177 CTTCCTGCAGGCGGACAGCAAGG - Intronic
1029675301 7:102064564-102064586 CTCCCTGCAGGGAGTCAGGCGGG + Intronic
1029919567 7:104248624-104248646 CTTCCTTCAGGAAGACCTGGTGG - Intergenic
1030228638 7:107181121-107181143 CTTCTTTCATGGAGTCATGAAGG - Intronic
1032688562 7:134259753-134259775 CTTCCTGCGAGCTGACATGAAGG - Intronic
1032740645 7:134735031-134735053 CTTCCTGCATTGGTACATGAGGG - Intergenic
1034778949 7:153859600-153859622 CCTGTTGCATGGAGACATGATGG + Intergenic
1035255508 7:157623454-157623476 CTTCCTTCAGTAAAACATGATGG + Intronic
1036070676 8:5438509-5438531 GCTGCTGCACGGAGACATGATGG + Intergenic
1036639750 8:10575273-10575295 GCTGCTGCACGGAGACATGATGG - Intergenic
1037422867 8:18722568-18722590 CTTCCTTCAGGTGGAAATGAAGG - Intronic
1037649042 8:20820019-20820041 CCTTCTGCAGGGAAACAAGAAGG - Intergenic
1037889218 8:22614622-22614644 CTTCCTCCTGGGTGAAATGAGGG - Intronic
1040577843 8:48670014-48670036 CATCCTGCAGGGAGCCAGGCTGG - Intergenic
1041550337 8:59093098-59093120 CTTTCTTCAGGGACACAGGATGG + Intronic
1041576362 8:59400427-59400449 CATCCTGCAGGATGAAATGAAGG + Intergenic
1044148306 8:88744294-88744316 CACGCTGCACGGAGACATGATGG + Intergenic
1047429182 8:124776030-124776052 CAGCCTGCAGAGAGTCATGAAGG - Intergenic
1047812360 8:128424624-128424646 CTTCCCCCAGGGAGCCAGGAGGG - Intergenic
1048763995 8:137826690-137826712 GCTGCTGCACGGAGACATGATGG + Intergenic
1048801581 8:138198969-138198991 CTTCCAGCAGGCAGACAAGGTGG - Intronic
1048978826 8:139692027-139692049 CTTCCTGCTGGGAGGGATGCTGG + Intronic
1049293519 8:141817060-141817082 CCTCCTGGAGGGAGACACGTGGG - Intergenic
1051157037 9:14159564-14159586 CTGCCTGCAGAGATGCATGAAGG - Intronic
1051298391 9:15620908-15620930 CTTCCTGAAGGGCCAGATGATGG + Intronic
1052888745 9:33676521-33676543 TTTCCTGCAGAAAGACTTGAAGG - Intergenic
1054171401 9:61843703-61843725 ACTGCTGCACGGAGACATGATGG + Intergenic
1054666133 9:67737109-67737131 ACTGCTGCACGGAGACATGATGG - Intergenic
1056024349 9:82477357-82477379 ATTCCCACAGGGTGACATGAAGG - Intergenic
1056423731 9:86455569-86455591 CTTCATGCATGGGGAAATGATGG + Intergenic
1057050008 9:91916430-91916452 CTCCCTGCAGGGAGTCCTGAGGG + Intronic
1057553948 9:96072677-96072699 CTTCCTTCAGGGTGACCTGGGGG + Intergenic
1059953440 9:119491574-119491596 CTGCCTGGAGCAAGACATGAGGG + Intergenic
1060173991 9:121483779-121483801 CTTCCTGCTGGGAAACTTGAAGG + Intergenic
1060763421 9:126275194-126275216 CTTCCTGCAGGCTGAGATGTCGG + Intergenic
1060781156 9:126414341-126414363 CCTCCTGCAGAGAGACGTGATGG + Intronic
1061937679 9:133867254-133867276 CTTCCTGGAGGGAGGCCTGGTGG - Intronic
1062176560 9:135166514-135166536 CTTCCAGTAGGGAAGCATGACGG + Intergenic
1185858210 X:3555214-3555236 GCTGCTGCAGGCAGACATGATGG + Intergenic
1185991275 X:4895212-4895234 GCTGCTGCAGGCAGACATGAGGG - Intergenic
1186204967 X:7191558-7191580 CTTCCTGCAGGGAGAGACCTGGG - Intergenic
1186375226 X:8991426-8991448 CTTCATGTAGGGCCACATGAAGG - Intergenic
1186674825 X:11805085-11805107 CTGACAGCAGGGAGACATGGAGG - Intergenic
1189030495 X:37444705-37444727 CTGTATGCAGGGTGACATGATGG - Intronic
1189487629 X:41445413-41445435 CTTGCTGCAGGGAGAAAAGCAGG - Intergenic
1191837657 X:65481539-65481561 ATTCCTGCAGGGAGCCTTCAAGG + Intronic
1195316766 X:103687114-103687136 TTTCCTGCAGGGAGGCATTATGG + Intronic
1196300242 X:114043822-114043844 GCTGCTGCATGGAGACATGATGG - Intergenic
1196388854 X:115189426-115189448 CATTCGGCAGGGAGACATGATGG + Exonic
1200287865 X:154841023-154841045 ATTTATGCAGGCAGACATGAGGG + Intronic
1202588162 Y:26453996-26454018 CTTCCTACAGGGAGAAAGGAAGG + Intergenic