ID: 927558723

View in Genome Browser
Species Human (GRCh38)
Location 2:24053884-24053906
Sequence CCTTCCTGCAGGGAGACATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 1, 2: 7, 3: 46, 4: 296}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927558723_927558734 21 Left 927558723 2:24053884-24053906 CCTCATGTCTCCCTGCAGGAAGG 0: 1
1: 1
2: 7
3: 46
4: 296
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558723_927558732 8 Left 927558723 2:24053884-24053906 CCTCATGTCTCCCTGCAGGAAGG 0: 1
1: 1
2: 7
3: 46
4: 296
Right 927558732 2:24053915-24053937 CAAGAAGGGCCAAACGTGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 90
927558723_927558728 -6 Left 927558723 2:24053884-24053906 CCTCATGTCTCCCTGCAGGAAGG 0: 1
1: 1
2: 7
3: 46
4: 296
Right 927558728 2:24053901-24053923 GGAAGGACATTCCCCAAGAAGGG 0: 1
1: 0
2: 1
3: 19
4: 203
927558723_927558727 -7 Left 927558723 2:24053884-24053906 CCTCATGTCTCCCTGCAGGAAGG 0: 1
1: 1
2: 7
3: 46
4: 296
Right 927558727 2:24053900-24053922 AGGAAGGACATTCCCCAAGAAGG 0: 1
1: 0
2: 1
3: 25
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927558723 Original CRISPR CCTTCCTGCAGGGAGACATG AGG (reversed) Exonic
900091627 1:923274-923296 CCTTCCTGCTGGGAGGTGTGGGG + Intergenic
900197875 1:1386266-1386288 CCTTCCTGCAGGGCCATAGGAGG - Intronic
900435475 1:2628858-2628880 CCATCCTGCGGAGAGACCTGAGG - Intronic
900938065 1:5779665-5779687 GAATCCTGCAGGGAGACCTGAGG + Intergenic
901179742 1:7333403-7333425 CCTTCCTGCAAGGTCACAGGTGG + Intronic
901865656 1:12105108-12105130 TCTTCCAGAAGGGAGGCATGAGG + Intronic
901974315 1:12932312-12932334 CAGTCTAGCAGGGAGACATGGGG - Intronic
902010859 1:13269456-13269478 CAGTCTAGCAGGGAGACATGGGG + Intergenic
902194014 1:14784419-14784441 CCTTAATGCAGGGAGAGAGGAGG - Intronic
902295057 1:15461555-15461577 CTGTACTGCAGGGAGACCTGGGG - Exonic
902297914 1:15481092-15481114 CTGTACTGCAGGGAGACCTGGGG - Exonic
902685974 1:18077921-18077943 TCTTCCTGCAGAGGAACATGGGG + Intergenic
902715028 1:18266839-18266861 ATGTCCTGCAGGGAGACAAGAGG + Intronic
902722381 1:18312662-18312684 CCTTATTGGAGGGAGACAGGAGG - Intronic
902937812 1:19777188-19777210 CCTCCCTGACGGGAGACTTGGGG + Intronic
903003034 1:20279849-20279871 CGGTCCTGCAGGGAGGCAGGGGG + Intergenic
903244468 1:22005644-22005666 CCCTCCTGCAGGCAGAGGTGAGG - Exonic
903868641 1:26416497-26416519 CATGCCTGCAGGAAGACAGGAGG - Intronic
904171406 1:28594069-28594091 GCTTCCTGCTGGGGGACCTGGGG - Exonic
904247090 1:29195448-29195470 CCTCCCTGCAGGGAGGTATGAGG - Intronic
905007076 1:34718398-34718420 CCTTCCTGCAGGCTGGAATGAGG - Intronic
905645307 1:39621250-39621272 CCTTCCTGGAGAGAGACAGTAGG - Intergenic
906289376 1:44610022-44610044 CCTGCTTGCAGGGATACCTGTGG + Intronic
907813921 1:57899899-57899921 ACTTCTGGCAGGGAGACAAGAGG - Intronic
908360947 1:63367837-63367859 CCTTCCTGCAGGGTCGCTTGTGG + Intronic
908802723 1:67897088-67897110 CCTTCCAGGAAGGAGACAGGAGG - Intergenic
910037856 1:82809983-82810005 CCTTCTTGTAGGGAGAGCTGGGG - Intergenic
910680851 1:89862861-89862883 CCTTCCTGCTGGAAGCCAAGGGG - Intronic
912484802 1:110017760-110017782 CCTTCCTAGAGGGAGTCTTGGGG + Intronic
912554185 1:110504255-110504277 CCTCATTGCAGGGAGACAGGGGG + Intergenic
913385504 1:118254183-118254205 CCTTTCTGAAGGGAATCATGAGG - Intergenic
913689625 1:121266943-121266965 CCTGCCTCCAGGCAGCCATGGGG - Intronic
914042972 1:144066144-144066166 CTTGCCTGCAGAGAGACATCTGG - Intergenic
914135114 1:144894344-144894366 CTTGCCTGCAGAGAGACATCTGG + Intronic
914147973 1:145013329-145013351 CCTGCCTCCAGGCAGCCATGGGG + Intronic
914687837 1:149997525-149997547 CCTTCTTGCAGGGAGAGTGGGGG + Intronic
914753363 1:150550067-150550089 CTCTCCAGCAGGGAGACCTGGGG + Intronic
915113341 1:153578934-153578956 GCTTCCTGCAGAGATACATTCGG - Intergenic
916190215 1:162171002-162171024 TCATCCTGCAGGGAGGCTTGGGG + Intronic
917647929 1:177047208-177047230 CTTTCCTAGAGGGAGTCATGGGG + Intronic
920256899 1:204661671-204661693 CCATCCTGCTGGGAGCCATGAGG + Intronic
920476948 1:206285417-206285439 CCTGCCTCCAGGCAGCCATGGGG - Intronic
920518339 1:206603087-206603109 CCACCCTGCAGGGAGACATGAGG - Exonic
921010005 1:211132750-211132772 TCTTCTACCAGGGAGACATGAGG - Intronic
921887049 1:220317449-220317471 CCTTCCTGCAGAGGGATATGCGG + Intergenic
922596236 1:226815600-226815622 CCTTCTTGCAGGAAGACTTCTGG + Intergenic
922726132 1:227923862-227923884 CCCCTCTGCAGGCAGACATGGGG + Intronic
922885352 1:229016083-229016105 CCTTCACGCAGGCAGAAATGGGG - Intergenic
922897684 1:229113145-229113167 CCTTACTGCATGGTCACATGGGG + Intergenic
923354075 1:233136623-233136645 CCTTGCTGCAGGAACACAGGGGG - Intronic
924258825 1:242209287-242209309 CCTGGCTGCAGGGAGTCCTGTGG - Intronic
924445634 1:244127823-244127845 CCTTCCTGCAGGGAGTGAATAGG + Intergenic
924866665 1:247990228-247990250 CCTTCCTGAAGGGAGACACAAGG - Intronic
924869143 1:248021909-248021931 CCTTCCTGAAGGGAGACACAAGG - Intronic
924870456 1:248038229-248038251 CCATCCTGAAGGGAGACAAAAGG - Intronic
924872186 1:248060643-248060665 CTTTCCTGAAGGGAGACACAAGG - Intronic
1063003015 10:1942432-1942454 CATACCTCCAGGGAGAGATGAGG + Intergenic
1063943070 10:11150633-11150655 TCTTCCTGCTGGTTGACATGGGG - Intronic
1064112747 10:12552682-12552704 CCTTCCTGCAAAGGGACATGCGG - Intronic
1066477167 10:35758665-35758687 CCTTCCTGCAAGCACACATCGGG + Intergenic
1067712880 10:48664330-48664352 CCTCGCTGCAGGGAGACTTCTGG + Intergenic
1067768824 10:49109091-49109113 GCTTCCTGGAGTGATACATGGGG - Intronic
1070106559 10:73438082-73438104 CCTTCCTGGATGGAGGCTTGAGG - Exonic
1070118199 10:73549743-73549765 TGTTTCTGCAGGGAGACAAGGGG - Intronic
1071278970 10:84082235-84082257 CCTTCCTCCTGGGAGCCAAGAGG - Intergenic
1072550775 10:96475678-96475700 GGTCCCTGGAGGGAGACATGGGG - Intronic
1073674211 10:105627006-105627028 CCCTCCTAAAGGGAGACATTTGG - Intergenic
1073957860 10:108893033-108893055 CCTTCCTTCAAGGAGACCTCTGG - Intergenic
1074163879 10:110858003-110858025 CTTTCATGCAGGGAGACAGCTGG + Intergenic
1075595656 10:123727299-123727321 GCTTTCTGGAGGGAGAGATGAGG - Intronic
1075611115 10:123855513-123855535 ACTTCCTGCCAGGAGAAATGTGG + Intronic
1076128514 10:127994766-127994788 CGTTCCAGCAGGGAGTCAGGAGG - Intronic
1076533531 10:131160977-131160999 CCATCCTGCAGCGTGATATGCGG + Intronic
1076609197 10:131710505-131710527 CCCTCCTGCAGGGACACGTGAGG - Intergenic
1077369684 11:2175669-2175691 CCTTCCTGCACGGAGCCCTCTGG + Intergenic
1077470428 11:2756265-2756287 CCCTCCTGCTGGGAGGCAAGTGG - Intronic
1077615360 11:3670096-3670118 CCTGCCTGCAGGGACACATGAGG + Intronic
1077918186 11:6624503-6624525 CCTATCTGCTGGGAGACAAGGGG + Intronic
1079959167 11:26901431-26901453 CCTTCCTAGATGGAGTCATGTGG + Intergenic
1081581302 11:44354128-44354150 CCTTCCTGCAGGGAGCACTGAGG - Intergenic
1081751746 11:45516110-45516132 GCTTCCTGGAGGCAGGCATGGGG - Intergenic
1083234776 11:61344329-61344351 CCTGCCTTCAGGGAAACAAGTGG - Intronic
1083282652 11:61636808-61636830 CCTTGCCGCAGAGGGACATGCGG - Intergenic
1083454697 11:62770958-62770980 CCTTCCTGAAGGGATAGATGGGG - Intergenic
1084273970 11:68042643-68042665 CCTTCCTGCAGGAGGAGGTGCGG + Exonic
1084540407 11:69782709-69782731 CTGTCCTGGAGGGAGACAGGGGG - Intergenic
1085311269 11:75518304-75518326 CCTTCCTGCCTGGAGAGATGAGG - Intronic
1088510045 11:110564958-110564980 CCCTCCTCCAGCCAGACATGGGG + Intergenic
1089630300 11:119780098-119780120 CCTCCCTGCAGAGTGGCATGGGG + Intergenic
1089866068 11:121632833-121632855 TCTTCATGAAGGGAGTCATGGGG + Exonic
1091620966 12:2088720-2088742 CCTTCGTGCTTGCAGACATGCGG + Intronic
1092042377 12:5395916-5395938 GCTTCCTGAAGGGCGACATCTGG - Intergenic
1093497200 12:19771840-19771862 CTTTCCTGCATGGGCACATGTGG + Intergenic
1094035299 12:26063985-26064007 TCCTCCTGAAAGGAGACATGGGG - Intronic
1095096209 12:38150729-38150751 CCTGCCTCCTGGGAGGCATGGGG + Intergenic
1096525370 12:52207143-52207165 CCTTCCTGCAGGGAGCCACCTGG - Intergenic
1097097643 12:56562399-56562421 TATGGCTGCAGGGAGACATGAGG - Exonic
1097796672 12:63870016-63870038 CCATCCTGCAGGGCTACATCAGG + Intronic
1098580584 12:72094515-72094537 CCTGCCTGCAGGGACACAGATGG + Intronic
1099367460 12:81785840-81785862 ACTTCCTGCAGTGAAATATGTGG + Intergenic
1099520923 12:83661161-83661183 ACTTGCTGCAGGGAGACACAAGG - Intergenic
1101452053 12:104788903-104788925 CACTCCTGCAGGGTCACATGGGG + Intergenic
1102982843 12:117256060-117256082 CCCTCCTTCAGGGAGAGATAGGG - Intronic
1103164646 12:118760063-118760085 CCTTCCTGCAGGCAGAGAGCAGG + Intergenic
1104557007 12:129809516-129809538 GCTTCCTGCATGAAGAAATGGGG + Intronic
1104941997 12:132399575-132399597 CCTCCCTGCAGGGAGACATGGGG + Intergenic
1105208456 13:18242783-18242805 CCTTTCTGCTGGAAGAGATGGGG - Intergenic
1106080652 13:26497751-26497773 CCATCCTGCAGGGTGTCCTGGGG - Intergenic
1107997231 13:45872860-45872882 CCTTCCTGGAGGGTAACACGTGG + Intergenic
1112156325 13:96821283-96821305 TCTACCTGCAGGGAGACAGCAGG - Intronic
1113955774 13:114099313-114099335 CCTCCCTGCATGGGGACACGCGG + Intronic
1116219381 14:42062871-42062893 CCTTCCTGGAGGTAGGCATGGGG - Intergenic
1116797093 14:49402994-49403016 CCTTTCTGCAGGGTGAATTGAGG - Intergenic
1117089050 14:52231393-52231415 CTTCCCTGGAGGGTGACATGGGG + Intergenic
1119324871 14:73753852-73753874 CCTGCCTACAGGGATACAGGGGG + Intronic
1119485264 14:74982624-74982646 CCTTTCTCCAGGGAGAGATGAGG + Intergenic
1119609907 14:76052956-76052978 CCTTACACCATGGAGACATGCGG - Intronic
1120702697 14:87715296-87715318 CCAGCCTGCAGGGACACTTGGGG - Intergenic
1120935580 14:89892396-89892418 GCTTCCTGCTGGGGGACCTGGGG - Intronic
1121325532 14:93017591-93017613 CGTGCCGGGAGGGAGACATGTGG - Intronic
1121794095 14:96721435-96721457 CTGTCCTGTAAGGAGACATGTGG - Intergenic
1121997052 14:98611015-98611037 TCTTCCTGCAGGAAGCCTTGTGG + Intergenic
1122047918 14:99036471-99036493 CCTTCCAGCTGGGAGTCCTGAGG + Intergenic
1123137798 14:106045541-106045563 CTTCCCTGCAGGAAGACAAGAGG - Intergenic
1123142594 14:106095231-106095253 CTTCCCTGCAGGGAAACAGGAGG - Intergenic
1123147064 14:106142226-106142248 CCTCCCTGCAGGGAGACAGGAGG - Intergenic
1123154455 14:106210876-106210898 CGTCCCTGCAGGAAGACAGGAGG - Intergenic
1123175856 14:106417958-106417980 AGTCCCTGCAGGGAGACAGGAGG - Intergenic
1123181013 14:106470203-106470225 CCTTGCTGCAGGAAGACAGGAGG - Intergenic
1123218212 14:106831671-106831693 CCTCCCTGCAGGGAGACAGGAGG - Intergenic
1202945893 14_KI270726v1_random:26576-26598 CCTCCCTGCAGGAAGACAGGAGG + Intergenic
1123582952 15:21731920-21731942 GCTCACTGCAGGGAGACAGGAGG - Intergenic
1123619602 15:22174516-22174538 GCTCACTGCAGGGAGACAGGAGG - Intergenic
1123931479 15:25173703-25173725 CTTTCCCGCATGGAGGCATGAGG + Intergenic
1123932866 15:25180253-25180275 CTTTCCTGCATGGAGGCGTGAGG + Intergenic
1123934862 15:25189164-25189186 CCTTCCTGCATGGAGGCGTGAGG + Intergenic
1123935301 15:25191184-25191206 CTTTCCTGCATGGAGGCATGAGG + Intergenic
1124884844 15:33675867-33675889 CCCTGCAGCAGGGAGACATTGGG + Intronic
1127316299 15:57797291-57797313 CCTGCCTTCAGGGAGGGATGTGG - Intergenic
1127686891 15:61354706-61354728 GCTTCCTGCAGTGAGAAAGGAGG - Intergenic
1127941198 15:63697895-63697917 ACTTCCTGCAGGGAGAACTATGG + Intronic
1128316392 15:66661916-66661938 CTTTGCTGCAGGGAGACCTATGG - Intronic
1128731987 15:70027356-70027378 CCTTCTTGAAGGCAGAGATGGGG - Intergenic
1129251446 15:74311241-74311263 CCTTCCCCCAGGGAGAGATGTGG + Intronic
1129323562 15:74787898-74787920 CCGTGCTGCAGGGAGACAGGAGG + Intronic
1129903818 15:79172228-79172250 CCTACCTGCAGGGTGACCTTGGG + Intergenic
1130221197 15:82021016-82021038 GCCTCTTGCAGGGAAACATGGGG - Intergenic
1132396326 15:101477780-101477802 CCTGCCTGCTGGGAGGCAAGTGG - Intronic
1133294841 16:4746662-4746684 CCTCCCTGCAGGGACCCAGGGGG - Intronic
1133538783 16:6727648-6727670 CCTTCCTTAAGGTAGAAATGAGG + Intronic
1134045646 16:11098944-11098966 CCTTCCAGCAGTGAGACCTGTGG + Intronic
1134250280 16:12569290-12569312 CCTTCCTGAAGCCAGCCATGGGG - Exonic
1136683628 16:31981854-31981876 ACTTTCTGCAGGGAGACACGGGG - Intergenic
1136691883 16:32038873-32038895 CCTCCCTGCAGGGGGACAGGAGG + Intergenic
1136784256 16:32925414-32925436 GCTTTCTGCAGGGAGACACGGGG - Intergenic
1136792471 16:32982435-32982457 CCTCCCTGCAGGGGGACAGGAGG + Intergenic
1136877346 16:33871472-33871494 CCTCCCTGCAGGGGGACAGGAGG - Intergenic
1136885528 16:33928392-33928414 GCTTTCTGCAGGGAGACACGGGG + Intergenic
1136994652 16:35181474-35181496 CCTTCCTGCTGGGACTCCTGGGG + Intergenic
1203086913 16_KI270728v1_random:1189420-1189442 GCTTTCTGCAGGGAGACACGGGG - Intergenic
1203094677 16_KI270728v1_random:1243900-1243922 CCTCCCTGCAGGGGGACAGGAGG + Intergenic
1144077094 17:11729270-11729292 TCAGCCTGCAGGGAGGCATGTGG - Intronic
1144803102 17:17944756-17944778 CCTTCCGGCGGGGAAACAGGAGG + Intronic
1145095275 17:20019982-20020004 TCACCCTGCAGGGAGACATGGGG - Intronic
1147144545 17:38477561-38477583 GCTTTCTGCAGGGAGACACGGGG - Exonic
1148104282 17:45111090-45111112 CCTGCCAGCAGGGTGAAATGTGG - Exonic
1149660970 17:58333690-58333712 CCTTCCTGGAGGGAAGGATGTGG - Intergenic
1151758399 17:76087593-76087615 CCTCCTTGCCTGGAGACATGGGG - Intronic
1151820864 17:76496072-76496094 CCTACCTGCTGGGAGACTTTGGG + Intronic
1151975050 17:77479903-77479925 GCTTCCTGAAGCCAGACATGGGG - Intronic
1152166337 17:78710047-78710069 CCTTCCAGCTGGGAGACTTCAGG + Intronic
1152465863 17:80465859-80465881 TCTTCCTGCAGGGACACAGGGGG + Intergenic
1152507063 17:80756550-80756572 CCTTGCTGCAGGAAGACTGGTGG - Intronic
1152898469 17:82926839-82926861 CCTCCCTGCAGGCACACAAGAGG + Intronic
1154215350 18:12411791-12411813 CCTCCCTGCAGGCAGCCGTGAGG + Intronic
1154251964 18:12752076-12752098 CCTTCCTGCTGGCTGACATGAGG + Intergenic
1156536412 18:37868872-37868894 TTTTCATGCAGGGAGACATAGGG - Intergenic
1157897815 18:51485292-51485314 CCCTCCTCCAGGGAGCCCTGGGG - Intergenic
1159552621 18:69911269-69911291 CCTTCCTCAAGGGAAAGATGGGG - Intronic
1160211008 18:76879695-76879717 TCTTCCTGCAAGGAGACTGGAGG - Intronic
1161103077 19:2430941-2430963 CCTTCCTGCAGGGGGACCCGAGG - Exonic
1162017158 19:7851987-7852009 CCTGGCCGCAGGGAGACAGGAGG + Intronic
1162918565 19:13887246-13887268 CCTTCCTGCCGGGAGCCACCCGG + Intronic
1162925600 19:13929451-13929473 CCATCCTGCCGGGCTACATGGGG + Intronic
1166668166 19:44694072-44694094 CTTTCCTGAAGGGAAAAATGAGG + Intergenic
926041390 2:9676119-9676141 CACTCCTGCAGGAAGACAGGAGG + Intergenic
927000983 2:18793914-18793936 CCTTCCTGCAGTGGTAGATGAGG - Intergenic
927558723 2:24053884-24053906 CCTTCCTGCAGGGAGACATGAGG - Exonic
927679893 2:25132331-25132353 GCTTCCAGGAGGGAGAGATGGGG + Intronic
928364421 2:30690373-30690395 CCTTCCTGCAGGCAGAGGTGAGG + Intergenic
928650437 2:33398392-33398414 CATTCTTGCAGAGAGACATCCGG - Exonic
928831427 2:35490150-35490172 ACTTCATCCAGGGAGACATATGG + Intergenic
929410137 2:41689782-41689804 CCTTGCTGCAGGCAGAGAGGTGG + Intergenic
929503557 2:42510466-42510488 CCTTCCTCCAGGGACAGAAGGGG - Intronic
930294929 2:49543375-49543397 CGTTTCTGCAGGTAGTCATGTGG + Intergenic
932574556 2:72955583-72955605 TCTTGCTCCAGAGAGACATGAGG + Intronic
933800965 2:85960067-85960089 CATTCCTGAAGGGAGACAAGGGG + Intergenic
934513173 2:94964479-94964501 CCTCCCTGCAGGGAGACAGGAGG - Intergenic
935505148 2:103891231-103891253 ACTTCCTTCAGGGAAGCATGTGG + Intergenic
935638944 2:105272542-105272564 CCTCCTTGCAGGGAGAAATAAGG - Intronic
936613803 2:114027867-114027889 CCTTCCATCAGGAACACATGTGG - Intergenic
938063682 2:128269977-128269999 CCTCCCTGCAGGGAGGTGTGCGG - Intronic
938252706 2:129827904-129827926 CCTCCAGGCAGGGAGAAATGAGG + Intergenic
938745418 2:134273398-134273420 CCTTCCTGAATGGAGACATGCGG + Intronic
942840862 2:180359462-180359484 ACTTGCTGCTGGGAGACTTGAGG - Intergenic
943780462 2:191817844-191817866 CCTTCAGGGAGGGAGAAATGAGG - Intergenic
947728813 2:232417073-232417095 CCTGCCTGCAGGGGGACATTTGG + Intergenic
948137248 2:235645681-235645703 CCTTCCTGCAGAGGGAGGTGGGG + Intronic
948711332 2:239827482-239827504 TCTTCGTGAAGGGAGATATGGGG + Intergenic
948990467 2:241551460-241551482 CCTACCTGCAGTGAGCGATGGGG - Intergenic
1169251913 20:4067620-4067642 CCTTGCTTCAGGGAGACAGAGGG + Intergenic
1169634438 20:7672499-7672521 CCTTCTAAAAGGGAGACATGTGG + Intergenic
1169906662 20:10611525-10611547 CCTTCCAGCAGGGGGAGGTGAGG + Intronic
1170453905 20:16514473-16514495 GCTTCCTGCTGGCACACATGTGG - Intronic
1171292854 20:23992600-23992622 CCTTTCTGCTGGAAGAGATGGGG - Intergenic
1173964667 20:47102973-47102995 CTTTCCTCCAGGGATTCATGGGG + Intronic
1175469750 20:59219104-59219126 TCTTCCTCCATGCAGACATGGGG + Intronic
1175905775 20:62378654-62378676 CCTTCCCGCAGGCTGCCATGGGG + Intergenic
1176985496 21:15431319-15431341 TCCTCCTGTAGGGAGAGATGTGG - Intergenic
1177950755 21:27533324-27533346 CATTCCTGTAGGGAGTCATAGGG + Intergenic
1180731827 22:17988066-17988088 ACTGCCCCCAGGGAGACATGGGG + Intronic
1180767803 22:18356559-18356581 CCTTTCTGCTGGAAGAGATGGGG + Intergenic
1180778505 22:18505831-18505853 CCTTTCTGCTGGAAGAGATGGGG - Intergenic
1180811229 22:18763139-18763161 CCTTTCTGCTGGAAGAGATGGGG - Intergenic
1180823912 22:18850313-18850335 CCTTTCTGCTGGAAGAGATGGGG - Intronic
1181124338 22:20693467-20693489 CCTTTCTGCTGGAAGAGATGGGG - Intergenic
1181188826 22:21124234-21124256 CCTTTCTGCTGGAAGAGATGGGG + Intergenic
1181197380 22:21197394-21197416 CCTTTCTGCTGGAAGAGATGGGG - Intergenic
1181210375 22:21286259-21286281 CCTTTCTGCTGGAAGAGATGGGG - Intergenic
1181415645 22:22756834-22756856 TCTCCCTGCAGGGAAACCTGGGG + Intronic
1181417943 22:22773591-22773613 TCTCCCTGCAGGGAAACCTGGGG + Intronic
1181423944 22:22820747-22820769 TCTCCCTGCAGGGAAACCTGGGG + Intronic
1181638823 22:24186464-24186486 CATTCCTGCAGGGAGACTGAGGG + Intronic
1181639876 22:24190835-24190857 CCATCCTGGAGGGAGACTGGTGG - Intergenic
1181746172 22:24956331-24956353 ACTTCCTGTGGGGAGACATGGGG + Intronic
1182117392 22:27764797-27764819 GCTTCCTCCAGGGTTACATGAGG - Intronic
1183870347 22:40737043-40737065 TCTTCCTGAAGGGAAACATTTGG + Intergenic
1184499949 22:44865557-44865579 TCTTGCTGCAGGGAGAAATGGGG + Intergenic
1184633321 22:45803755-45803777 CCATCCTGCTGGTAGACGTGGGG + Intronic
1184721793 22:46318906-46318928 GCTTCCTGCCGGGAGGTATGAGG - Intronic
1203216572 22_KI270731v1_random:9172-9194 CCTTTCTGCTGGAAGAGATGGGG + Intergenic
1203229419 22_KI270731v1_random:97441-97463 CCTTTCTGCTGGAAGAGATGGGG + Intergenic
1203274056 22_KI270734v1_random:76217-76239 CCTTTCTGCTGGAAGAGATGGGG - Intergenic
949806893 3:7965120-7965142 ACTTACTGCAGGGACACCTGAGG - Intergenic
950409686 3:12827429-12827451 CCCTCCTGCAGGTGGAGATGGGG + Exonic
950426267 3:12926366-12926388 CCATCCTTCAGGGTCACATGTGG - Intronic
950561919 3:13735838-13735860 GGTCCCTGCTGGGAGACATGGGG + Intergenic
950725263 3:14913177-14913199 CTTTCCTGGGGGGAGACTTGAGG - Intronic
954135599 3:48580771-48580793 AGTCCCTGCAGGGAGGCATGGGG - Intronic
954381664 3:50222075-50222097 CCATCCTGCAGGCAGACCTGGGG + Intergenic
960968683 3:123123810-123123832 TCTTCCTGCAGGGAGGCAGAGGG + Intronic
960988457 3:123295465-123295487 CCTTCCTCCAGGGAGACACAAGG + Intronic
961431954 3:126889866-126889888 CGTTCCAGCAGGGAGATGTGAGG + Intronic
963301025 3:143597363-143597385 CCTTCTTGCAGACAGACAGGAGG + Intronic
968632908 4:1661408-1661430 ACTTCCTGCAGGGAGGCGGGTGG - Intronic
968779579 4:2570256-2570278 CAACCCTGCAGGGAGACATAAGG - Intronic
968958875 4:3732697-3732719 CCATGCTGCATGGAGAAATGAGG - Intergenic
969317408 4:6390512-6390534 CCCTGCTGGAGGGTGACATGGGG - Intronic
969439946 4:7211161-7211183 CCTTCCTGCCTGGAGAAATTTGG + Intronic
971390718 4:26182891-26182913 CCTTCCAGTAGGAAGAGATGTGG - Intronic
977439349 4:97042830-97042852 CCTTCCTGCTGGGAGATCTCTGG - Intergenic
979990214 4:127366639-127366661 CCTTCCTCCAGAGTGACAGGTGG + Intergenic
983012192 4:162561951-162561973 CATTCCTGCAGAGAGACCTCTGG - Intergenic
983654757 4:170071629-170071651 CATTTCTGCAGGGACAGATGTGG + Intronic
983795644 4:171859428-171859450 CCTTCCTGAAGGGACTCAAGGGG - Intronic
985700999 5:1372481-1372503 GCTTCCTGCAGGCTGACAAGTGG + Intergenic
985836159 5:2273347-2273369 CCTACCAGCAGGGAGGCATGAGG + Intergenic
986051553 5:4094815-4094837 CCATCCTTCCAGGAGACATGGGG - Intergenic
986226999 5:5825076-5825098 CCTTCCTACAAGGAGAGAAGAGG + Intergenic
986558974 5:9041626-9041648 CCTCCATGCAGGGAGAGGTGAGG + Exonic
986729603 5:10625549-10625571 CCTTCCTGCACGGGGATGTGTGG + Intronic
986737908 5:10681542-10681564 GCTTCCTGCAGGGACACTGGTGG - Intronic
986737924 5:10681601-10681623 GCTTCCTGCAGGGACACTGGTGG - Intronic
989624563 5:43416906-43416928 CCTGCCAGCAGGAAGACATAGGG + Intergenic
990889598 5:60633533-60633555 GCCTGCTGGAGGGAGACATGTGG + Intronic
991094901 5:62729390-62729412 CCCTACTGCTTGGAGACATGCGG + Intergenic
992487179 5:77208916-77208938 CCTCCCTGCAGGGATGCCTGAGG + Intergenic
992638413 5:78747498-78747520 CCATCCTGCTGGCAGACTTGTGG - Intronic
994009217 5:94880328-94880350 CCTTCCTGCAGAAAAGCATGAGG + Intronic
996001482 5:118369270-118369292 CCTCCATGCAGGGCCACATGGGG - Intergenic
997610348 5:135211548-135211570 CCTGTCTCCAGGGAGACAGGAGG + Intronic
998042975 5:138965042-138965064 CTTTCCTGCAGGGAGGCTGGGGG + Intronic
1001048983 5:168399225-168399247 CCTTGCTCCAGGGAAACAGGTGG - Intronic
1001288595 5:170440766-170440788 CCTACCTCCAGGGAGAGTTGGGG + Intronic
1001327214 5:170737873-170737895 GCTTCCTGCATGTAGCCATGTGG + Intergenic
1003120464 6:3315250-3315272 CCTCCCTGCAGGCACAGATGGGG - Intronic
1003190438 6:3869806-3869828 CCTGCCTGATGGGAAACATGGGG + Intergenic
1003460157 6:6321202-6321224 CATTCCTGCAGGAAGTCTTGTGG - Intergenic
1003605357 6:7555052-7555074 TCTTCCTGCAGAGGGACTTGTGG + Intronic
1005273181 6:24187745-24187767 CCTTCCTGAAGGCACATATGAGG - Intronic
1005661072 6:28000319-28000341 CAGGCCTGCAGGGAGAAATGAGG + Intergenic
1005755669 6:28923435-28923457 CCTTCCCGCAGAGGCACATGCGG - Exonic
1005858636 6:29884380-29884402 CCTTCCTGCAGGGCTGCTTGTGG - Intergenic
1005909381 6:30294667-30294689 CCTTTCAACAGGGAGACATCAGG + Intergenic
1006800356 6:36755982-36756004 CCTTCCTGCAGGAAGTCCCGTGG + Intronic
1007180816 6:39927862-39927884 CCGTCCTGCAGAGAGAAAGGAGG + Intronic
1007835087 6:44667963-44667985 CCCACCTGCAGGGAGAAAAGAGG - Intergenic
1007938650 6:45756024-45756046 TCATCCTGCAGGTAGCCATGAGG - Intergenic
1008033241 6:46720149-46720171 GCTTGCTGCAGGGAGACCTCTGG + Intronic
1011508775 6:88077406-88077428 CCTTACTGCAGGCTGAAATGTGG - Intergenic
1013658760 6:112272928-112272950 CCTTAATACAGGGAGACATTTGG + Intergenic
1016328187 6:142926856-142926878 CCTTCCTGCCGGGAGAAAGTGGG - Intronic
1018654596 6:166023468-166023490 CGTGACTGCAGGGAGGCATGAGG + Intergenic
1019398023 7:833981-834003 CCTTCCTTCAGTGAGACCTGTGG + Intronic
1019471899 7:1225500-1225522 TCATCCCGCAGGGAGACACGGGG - Intergenic
1022486543 7:30783305-30783327 CCTTCTTAGAAGGAGACATGAGG - Intronic
1023609276 7:41957360-41957382 TCTTCCTGCAGGGAGGGAGGAGG + Intergenic
1024612827 7:51081751-51081773 CCTTCCTGCAGGAAAAAGTGAGG - Intronic
1026658465 7:72277738-72277760 TCTTCCTTCTGGGAGAAATGAGG + Intronic
1027651964 7:80879284-80879306 ACTTCCTGGAGGTAGACAAGAGG + Intronic
1027925762 7:84461309-84461331 CCTTCCTGGAGGGACACAGCAGG - Intronic
1029675300 7:102064563-102064585 GCTCCCTGCAGGGAGTCAGGCGG + Intronic
1030585554 7:111414191-111414213 TCTTCCTGCAGGGGAACAGGAGG - Intronic
1031785276 7:126022489-126022511 CCTTACTGAAGGGAGAAATTTGG + Intergenic
1032761483 7:134947444-134947466 CCTTCCTCCAGGGAGACTACAGG + Intronic
1034221471 7:149449777-149449799 CCTTCCTGCAGACAGAAAAGAGG - Intronic
1034609308 7:152351037-152351059 CCTTCCAGCAGGGCAAAATGTGG - Intronic
1035751177 8:1997507-1997529 CCATTCTGCAGGGAGACCCGCGG + Intronic
1037889219 8:22614623-22614645 CCTTCCTCCTGGGTGAAATGAGG - Intronic
1039867074 8:41514550-41514572 CCTTCCAGCAAGCACACATGAGG - Intergenic
1040652344 8:49463851-49463873 CCTTCCTAAAGGGAGATGTGAGG + Intergenic
1041737499 8:61126989-61127011 CCTTCCTGCAGTGTGAGATGGGG + Intronic
1045066835 8:98455310-98455332 ACTTTCTGCAGGGAGCTATGGGG - Exonic
1049064784 8:140304534-140304556 CCTTCCTTCAGGTGGAGATGAGG + Intronic
1049293521 8:141817061-141817083 TCCTCCTGGAGGGAGACACGTGG - Intergenic
1049843827 8:144790260-144790282 CCCTCCTGCAGGGACACCTGTGG + Intronic
1050869287 9:10546313-10546335 GGTTCCTTCATGGAGACATGAGG - Intronic
1053094015 9:35308248-35308270 CTGTCCTTCAGGGAAACATGAGG + Intronic
1053413070 9:37928245-37928267 CCCTCATGGAGGGAGACAGGTGG + Intronic
1054919502 9:70527860-70527882 CCTTCCTGCAGCCTCACATGGGG - Intergenic
1056476859 9:86961133-86961155 CCTTCCTTCAGGGAAGCATATGG - Intergenic
1056714195 9:89014632-89014654 CCCTCCTGCAGGGACTCCTGAGG + Intronic
1056752084 9:89359252-89359274 CCGTCCTGCAGGGAGCCACTTGG + Exonic
1057050007 9:91916429-91916451 ACTCCCTGCAGGGAGTCCTGAGG + Intronic
1057553947 9:96072676-96072698 CCTTCCTTCAGGGTGACCTGGGG + Intergenic
1060214312 9:121729454-121729476 CCTTACTGCAGGAAGGCAGGTGG - Intronic
1060515972 9:124266057-124266079 CCCACCTGGAGGGAGACGTGGGG + Intronic
1060849377 9:126861226-126861248 CCTTCCTCCAGGTAAACAGGCGG + Intronic
1061163643 9:128910234-128910256 GATTCCTGTAGTGAGACATGTGG + Intronic
1061575634 9:131504028-131504050 CCTTGGTTCAGGTAGACATGTGG - Intronic
1062006890 9:134243074-134243096 TCTTCCTGCAGGGAGCCAGGAGG + Intergenic
1186062518 X:5725602-5725624 CCTTCCTGCAGGGAGTTGAGTGG - Intergenic
1186204968 X:7191559-7191581 TCTTCCTGCAGGGAGAGACCTGG - Intergenic
1186273402 X:7914685-7914707 CTATTCTGCAGAGAGACATGTGG + Intronic
1188956144 X:36436726-36436748 ACTCACTGCTGGGAGACATGAGG + Intergenic
1190708694 X:53050092-53050114 GCTACCTGTAGGGAGAGATGGGG - Intronic
1192849676 X:74942044-74942066 GCTTCCTGCAGGGGGACATGGGG + Intergenic
1197070140 X:122286711-122286733 ACTTCCTGCTGTGAGACAGGTGG - Intergenic
1197127363 X:122963013-122963035 CCTACCTGCAGGCACACAGGAGG - Intergenic
1199391798 X:147288823-147288845 CCTTCCTAAAGGCAAACATGAGG - Intergenic
1199537663 X:148921409-148921431 GCTTACTGGAGGGAGAAATGAGG - Intronic