ID: 927558725

View in Genome Browser
Species Human (GRCh38)
Location 2:24053894-24053916
Sequence TGGGGAATGTCCTTCCTGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927558725_927558734 11 Left 927558725 2:24053894-24053916 CCCTGCAGGAAGGACATTCCCCA 0: 1
1: 0
2: 1
3: 17
4: 175
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558725_927558732 -2 Left 927558725 2:24053894-24053916 CCCTGCAGGAAGGACATTCCCCA 0: 1
1: 0
2: 1
3: 17
4: 175
Right 927558732 2:24053915-24053937 CAAGAAGGGCCAAACGTGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927558725 Original CRISPR TGGGGAATGTCCTTCCTGCA GGG (reversed) Exonic
902453731 1:16516396-16516418 TGGAAAATGGCCCTCCTGCATGG + Intergenic
902473785 1:16669060-16669082 TGGAAAATGGCCCTCCTGCATGG + Intergenic
902485018 1:16738382-16738404 TGGAAAATGGCCCTCCTGCATGG - Intergenic
902498753 1:16893865-16893887 TGGAAAATGGCCCTCCTGCATGG - Intronic
902540171 1:17149085-17149107 TGGGGAAGTTCCTTCCCGCTGGG + Intergenic
902917731 1:19648680-19648702 TGGGGAATTTCCTTTCTGTGTGG + Intronic
903730389 1:25489647-25489669 AGGGGACTGACCCTCCTGCATGG + Intronic
906196070 1:43931543-43931565 TGGGGCATGTCCTTCCCAGAGGG - Intergenic
907552668 1:55317518-55317540 TGGGGGATGTCCTTCCCACTGGG + Intergenic
907872901 1:58459006-58459028 TGGAGAAAGTCCTTAATGCATGG + Intronic
915459894 1:156063713-156063735 TGGGGCAAGTCCTTCCTTGAAGG + Intronic
915930535 1:160058015-160058037 TGGGGATGGTCCTTCCTGGAAGG - Intronic
915994186 1:160547487-160547509 TGGAAAATGTTCTTTCTGCAGGG - Intronic
917173344 1:172201971-172201993 AGGGGAACCTCCTTCTTGCAGGG - Intronic
917207815 1:172596465-172596487 GGTGGAATGTCCTTCCTGTTTGG + Intronic
917789240 1:178488751-178488773 TGGTGAATGTGTCTCCTGCAGGG - Intergenic
919777118 1:201201547-201201569 TGGAGAATTTCCTTCCTTGAGGG + Intronic
920309262 1:205039032-205039054 TGGGGAATGTGTTTCTGGCATGG - Intergenic
924774267 1:247104584-247104606 ATGTGAATGTCCTTCTTGCATGG - Intergenic
924925064 1:248671770-248671792 TGGGGACCCTCCTGCCTGCAGGG - Intergenic
1063317800 10:5023196-5023218 TGGGGAATGACCTGCTTCCAAGG + Intronic
1066545239 10:36492509-36492531 TGGGCAATGTCCCTTCTGTATGG - Intergenic
1069795922 10:71051663-71051685 TGGGGACTCTCCTTCCTCCCTGG - Intergenic
1070636444 10:78132103-78132125 GGGGGAATGAGCTTGCTGCATGG + Intergenic
1070918881 10:80171732-80171754 TAGGGAAGGTTCTTCCTGGAGGG - Intronic
1071391078 10:85175886-85175908 AGGGGAAGTTCCTTCCTGTAGGG + Intergenic
1071563979 10:86662244-86662266 TGGGCAATGGCCACCCTGCAGGG - Exonic
1076264791 10:129101189-129101211 TGGGGATTGTCCTGCCTCCCAGG - Intergenic
1076414903 10:130278889-130278911 TGCTGCATGTCCTGCCTGCATGG - Intergenic
1076418642 10:130311420-130311442 TGGGGTAAGACCTACCTGCATGG - Intergenic
1077265290 11:1645518-1645540 TGGGGACTGCCCCTCCTGAAGGG - Intergenic
1077338379 11:2015469-2015491 TGGGCAATGCCCCTCCCGCAGGG + Intergenic
1077439259 11:2560437-2560459 TGGGGGATGTCCATCCTGGGGGG + Intronic
1080687947 11:34531098-34531120 TGAGGAATGTGTTTCTTGCAGGG - Intergenic
1080893114 11:36426858-36426880 TGTGGAAAGTTCTTCCTGCTGGG + Intronic
1081444433 11:43116900-43116922 TGGGGAATGGATTTCCTGCAGGG - Intergenic
1082789785 11:57339184-57339206 TGAGGAATTTCCTTCTGGCATGG + Intronic
1083299130 11:61731148-61731170 GGAGGAGTGTCCTTCCTCCAAGG + Intronic
1083768845 11:64855208-64855230 TGGGGAAGGGCCTCCCTGAACGG - Intronic
1084148004 11:67275234-67275256 TGGGCACTGTCCTTCCAGGAAGG - Intronic
1090302949 11:125662343-125662365 TGGGGCAGGACCTTCCTGAATGG - Intronic
1202821363 11_KI270721v1_random:70651-70673 TGGGCAATGCCCCTCCCGCAGGG + Intergenic
1092330491 12:7582725-7582747 GGGGGAGTGTCCTTTCTGCATGG + Intergenic
1096529009 12:52231923-52231945 GACGGAATGTCCTTCCTGCTTGG - Intergenic
1096999819 12:55867205-55867227 GGGGGAATGTCCTTGCAGCAAGG - Intergenic
1097736911 12:63192652-63192674 TGGGGTGTGTCCTCACTGCATGG - Intergenic
1098253344 12:68591115-68591137 TGGAGATGGTCCTTCCTGAATGG + Intergenic
1101202776 12:102454390-102454412 TGGGGCATGTACTTCCTTCTAGG - Intronic
1101204227 12:102469183-102469205 TGGGGAAGTTTCTTCCTGCCTGG + Intronic
1102524242 12:113500004-113500026 TGTGGAATGTCCTCCTTGCATGG + Intergenic
1104179100 12:126360869-126360891 TGGGGATGCTCCCTCCTGCAGGG + Intergenic
1105600123 13:21879217-21879239 TAGGGAATTCGCTTCCTGCATGG + Intergenic
1106413979 13:29530761-29530783 CTGGGAAGGTCCTTCCTGGATGG + Intronic
1110339200 13:74369241-74369263 TGGGGAATGTATTTCTTGCTGGG + Intergenic
1111091032 13:83447713-83447735 TAGGGACTGTCTTTTCTGCATGG + Intergenic
1113518173 13:110919126-110919148 TGGGTAATGTCCTTACAGCCAGG + Intergenic
1115532715 14:34341996-34342018 TTTGGAATGTCCTTGCTGAAAGG + Intronic
1118048327 14:61997238-61997260 GGTGGAATGTCCTTACTTCAAGG - Intronic
1119719534 14:76881865-76881887 TTGGGAAGGTCCCTCCTCCATGG - Intergenic
1120511418 14:85420573-85420595 TGGGAAATTTCATTCCAGCATGG + Intergenic
1122664711 14:103320555-103320577 TAGGGAATGTCCACACTGCAGGG - Intergenic
1129508333 15:76101795-76101817 GGGGAAATGACCTGCCTGCAGGG - Intronic
1130421063 15:83747556-83747578 TGGAGAATGTCCTTCAGCCAGGG - Intronic
1132226910 15:100149933-100149955 TGGTGATTGTCCTGCTTGCAAGG - Intronic
1135589892 16:23697368-23697390 TGGGTGATGTACTTCCAGCAAGG - Intronic
1135940210 16:26815785-26815807 AAGGGAGAGTCCTTCCTGCAGGG - Intergenic
1140378965 16:74469169-74469191 GGGGGAATGTCTTTCCTGTAAGG + Intronic
1142054245 16:87982766-87982788 TGTGGATTTTCCCTCCTGCAGGG + Intronic
1142889959 17:2936791-2936813 TGGGCAATGGCTCTCCTGCAAGG - Intronic
1144706319 17:17370777-17370799 TGGGGAATCTCCCTCATGCTGGG + Intergenic
1144801188 17:17928834-17928856 TGAGGAATGCCTTTCCTGAATGG - Intronic
1147855290 17:43475266-43475288 TGAGGCATGTGCTTTCTGCAGGG + Intergenic
1149723217 17:58866399-58866421 GGGGGAACGTCCTTGCAGCAAGG - Intronic
1152297700 17:79477891-79477913 TGGGGTCTCTCCTTCCTACAGGG - Intronic
1152713193 17:81885178-81885200 TGTGGAGTGTCCGCCCTGCAAGG + Intergenic
1152797914 17:82317025-82317047 CAGAGAATGTCCTCCCTGCAGGG + Intronic
1155087303 18:22471023-22471045 TGGGGAATGACTTTCCTGCAGGG + Intergenic
1155237986 18:23840640-23840662 TGGATAATTTCCTACCTGCAAGG - Intronic
1156422247 18:36967597-36967619 TGGGAAATGTTCCTCCTGCCTGG - Intronic
1157501436 18:48193673-48193695 TGGTGAGTGTCCATCCTGCTGGG - Intronic
1161899773 19:7109774-7109796 ATGGGAATGTCCATCCTGAAGGG + Intergenic
1164413573 19:28026338-28026360 TGTGGAATGGCCAGCCTGCAGGG - Intergenic
1164506404 19:28864779-28864801 TGGGGAATGACCTTCTGGCTGGG + Intergenic
1164822811 19:31263567-31263589 TGGGGGAGGGACTTCCTGCATGG + Intergenic
1165257196 19:34585370-34585392 TGTGCCATTTCCTTCCTGCAGGG + Intergenic
1165265062 19:34655032-34655054 TGTGCCATTTCCTTCCTGCAGGG - Intronic
1167268827 19:48497196-48497218 GGGCAAATGTCCTTGCTGCACGG - Intronic
1167650900 19:50728076-50728098 TGGGGAGTGGCGTGCCTGCAAGG + Intergenic
1167791379 19:51684872-51684894 TGGGGATTATCCCACCTGCAGGG + Intergenic
926198270 2:10776486-10776508 TGGGGAAAATCTTTCCTGCCTGG - Intronic
927096240 2:19749671-19749693 TGGGAAACATCCGTCCTGCAGGG - Intergenic
927515193 2:23668157-23668179 TGTGGATAGCCCTTCCTGCATGG + Intronic
927558725 2:24053894-24053916 TGGGGAATGTCCTTCCTGCAGGG - Exonic
927854405 2:26518902-26518924 TGGGGAATGCCTCTCATGCATGG - Intronic
929750464 2:44706782-44706804 TGGGGAACGACGTTCCTGAATGG - Intronic
931317162 2:61143808-61143830 TTGGTGATGTCCTTCCTGTAAGG + Intergenic
931889420 2:66654577-66654599 TGGGGTTTGTTTTTCCTGCAGGG - Intergenic
932886649 2:75554787-75554809 TGGGGACCATCCTTCCTCCAGGG - Intronic
943712523 2:191112964-191112986 ATGGGAATGCCCTTCCTGCTAGG - Intronic
944852208 2:203731478-203731500 AGGGGAATGCCTTTCCTGGAGGG - Intronic
948106488 2:235418399-235418421 TGGGGCATGTGCTTCCTGAAAGG - Intergenic
948863497 2:240764034-240764056 TTGGGACAGTCCTGCCTGCAGGG + Intronic
1169385638 20:5147086-5147108 TGGGAAATGTCCCTCCTGAGGGG + Intronic
1172408857 20:34708094-34708116 TGGGCAATTTCCTCCCTGCCTGG + Intronic
1172512427 20:35509818-35509840 TGGGGCCTCTCCTTGCTGCAGGG + Intronic
1173681430 20:44885363-44885385 TGGGGATTGCCCTTTCTGCTGGG - Intergenic
1174588096 20:51624274-51624296 TGGGGCCTGTCCTTTCAGCAGGG - Intronic
1174676862 20:52366375-52366397 TGGGGAATATACTTCCTAAAGGG + Intergenic
1175828574 20:61950285-61950307 AGGAGAATGTCCTTCCTGGGCGG - Intergenic
1176124080 20:63467373-63467395 TGCGGAACGTCATTCCTACAGGG + Intronic
1178580653 21:33835277-33835299 TGAGGAATGTGGTTCCCGCAGGG + Intronic
1178763502 21:35427170-35427192 TGGGGAGTATTCATCCTGCATGG + Intronic
1179347290 21:40570418-40570440 AGGAGCATGTCCTTCCTGCAAGG + Intronic
1179386096 21:40943589-40943611 TGGTGAATATACTTCCTCCATGG + Intergenic
1180917430 22:19498976-19498998 TGGGGAATGTCCTGCCAGTGGGG - Intronic
1181721758 22:24780666-24780688 GGGGGAATCCCCATCCTGCATGG + Intergenic
1184142128 22:42584053-42584075 TGGTAAATATCCTCCCTGCATGG - Exonic
1184669761 22:46006553-46006575 TGGTGCCTGTGCTTCCTGCAAGG + Intergenic
1184739026 22:46416404-46416426 TGGGAATTGCCTTTCCTGCAAGG - Intronic
950505392 3:13391388-13391410 TGTGGAGTGTGGTTCCTGCATGG - Intronic
950685354 3:14613749-14613771 TAGGGCCTGTCCTTCCTGCTGGG - Intergenic
952673598 3:36000327-36000349 TGGGGAAGGTCCTCCCAGCTGGG - Intergenic
952696292 3:36268438-36268460 GCAGGAATGGCCTTCCTGCAGGG - Intergenic
953879849 3:46685982-46686004 AGGGGACTCTCCTCCCTGCAGGG + Intronic
954343755 3:49978368-49978390 TGAGCAATATCCATCCTGCATGG - Intronic
955558594 3:60164194-60164216 TGGTTAATGTCCATCCTGCCAGG - Intronic
955660367 3:61292510-61292532 TGGGGAAGACCCTTTCTGCAGGG + Intergenic
956072346 3:65466761-65466783 AGGGGAATTTCCTTACTGCCTGG + Intronic
956811514 3:72867957-72867979 TGGGGACTGGCCTTCCACCATGG + Intergenic
959524515 3:107361549-107361571 TGGGGAATTGACTTCCAGCAAGG - Intergenic
962625662 3:137223478-137223500 TGGGGAATGTCCTGGCAGCAGGG + Intergenic
962737922 3:138342273-138342295 TGGGGAAGGCCCTTCCTTCTTGG + Intergenic
962747195 3:138405685-138405707 TGGGGTGTCTCCTTCCTGCATGG + Intergenic
963001353 3:140684714-140684736 TTGGTAATGTGGTTCCTGCAGGG - Intronic
963134035 3:141884276-141884298 TTGGAAGTGACCTTCCTGCAAGG + Intronic
963381181 3:144532176-144532198 TAGGGAATGTGCTTCCTCCAAGG - Intergenic
964501887 3:157356897-157356919 TGGGGACTGTCTTTACTCCAAGG - Intronic
964707702 3:159637530-159637552 TCTGGCATGTCCTTCCTGCCTGG - Intronic
965835659 3:172849128-172849150 TGTGAAATGTCTTTCCTCCAGGG - Intergenic
969598626 4:8162804-8162826 TGGGGAATACTTTTCCTGCATGG + Intergenic
976759472 4:88532806-88532828 TGGGGAATTTTCTTTTTGCAAGG + Intronic
977361801 4:96014899-96014921 TTAGGAATCTCCTTCCTCCAAGG - Intergenic
978250971 4:106631222-106631244 TGGGGACTTTCCATCCTGGAAGG + Intergenic
979178155 4:117691596-117691618 TGGGGAATGTCTTACCAGAATGG - Intergenic
980096366 4:128495238-128495260 TGGGGATGGTCCTTCATGAATGG + Intergenic
983215715 4:165000560-165000582 TTGGGAATTTCCTTGCGGCAAGG - Intergenic
984146408 4:176066197-176066219 AGGGTAATGTACGTCCTGCAGGG + Intronic
985825768 5:2190580-2190602 AGGAGAAAATCCTTCCTGCAGGG + Intergenic
986541133 5:8844866-8844888 GGAGGAATGTTCTTCCTGCAAGG - Intergenic
987431058 5:17833543-17833565 TGGGAAATGTTTTTCCTCCATGG - Intergenic
992194383 5:74325170-74325192 TGGAGCAAGTCCTTCCTTCACGG - Intergenic
992551907 5:77867022-77867044 TGTGGAATGTCCTTACTGATGGG - Intronic
994114456 5:96046519-96046541 TAGGGCATGTCTTTCCTCCATGG - Intergenic
995601939 5:113807032-113807054 AGAGGAAAGTCCTTCCTGCCTGG + Intergenic
997093168 5:130880203-130880225 TAGGCAATGTCCTTTCTGCCTGG - Intergenic
998883867 5:146673907-146673929 AGGGGAATTTTCTTCCAGCAAGG + Intronic
999285687 5:150392909-150392931 TGGGCAAGGTCCTGTCTGCAAGG + Intronic
1003138714 6:3454663-3454685 TGGGGAAGGTCCTTCTAGCTGGG - Intronic
1004180355 6:13375988-13376010 TGGGGAATGCCCCTGCTGGAAGG - Intronic
1007094062 6:39202563-39202585 CTGGGACTGTCCTTCCTGCAGGG + Intronic
1007161892 6:39798148-39798170 TAGGGAAGGTCATTACTGCATGG + Intronic
1009759673 6:67988403-67988425 GGAGGAATGTCCTTCTTCCATGG - Intergenic
1012841217 6:104331139-104331161 TGGGGAATGGCGTTCGTACAAGG - Intergenic
1016379790 6:143464314-143464336 TGGTGAATCTGTTTCCTGCAAGG + Intronic
1018625214 6:165771356-165771378 TGTGAAATGTCCTTCCAGCTCGG + Intronic
1021201453 7:17732391-17732413 AGGGGAATGTCCTTGCAGCAAGG + Intergenic
1021214549 7:17900579-17900601 TGGGGACTGTGCTTGCTGTAGGG - Intronic
1021633933 7:22672787-22672809 TGGGTATTGGCCTTCCTGGATGG - Intergenic
1021877183 7:25059899-25059921 AGGGGCATGTCCTTCCTTCGTGG - Intergenic
1027191020 7:75995391-75995413 TGGGGAAGGTCCTGCATGGATGG + Intergenic
1034948087 7:155277018-155277040 TGCGGACTGTCCTCCCTGCTGGG - Intergenic
1037313475 8:17579419-17579441 TTGGGAATATCCTGCCTTCAAGG + Intronic
1039392092 8:37189506-37189528 TGGGGAGTGTCAGTGCTGCATGG + Intergenic
1043253028 8:78100059-78100081 TGCAGCATGCCCTTCCTGCAAGG - Intergenic
1045554033 8:103197832-103197854 TGGGGCATATCCTTCATGAATGG - Intronic
1048276255 8:133068227-133068249 TGGGCATTGCCCCTCCTGCAGGG - Intronic
1049248962 8:141578083-141578105 TGGGGAATGTCTTTGCTTCTCGG - Intergenic
1053107027 9:35418356-35418378 TTGGTAATGTCCTTTTTGCAAGG - Intergenic
1053222720 9:36325508-36325530 TGGGGCATTTCCCTCCAGCATGG + Intergenic
1058069413 9:100586340-100586362 TGGGGATTTCCCTTCCTTCATGG - Exonic
1059165105 9:112069822-112069844 AGGGGGATGGCCTTCCTGCTCGG - Intronic
1059434707 9:114269110-114269132 TGGGGAAGGTCCTTCTTCCCAGG - Intronic
1061861680 9:133471694-133471716 TGGGGCGTGTCCTTCACGCAAGG + Exonic
1062128637 9:134880612-134880634 TGGCGACTGTCATCCCTGCAGGG - Intergenic
1062689545 9:137834214-137834236 TGGAGAAGGCCCCTCCTGCATGG + Intronic
1186178870 X:6953669-6953691 TAGGGAATGTTCTTGCTGCAGGG - Intergenic
1187601192 X:20832453-20832475 TGGGCACTGTCCCTCCTGCTGGG - Intergenic
1187630426 X:21163336-21163358 TGAGCAGTGTCCTTTCTGCATGG + Intergenic
1187770671 X:22692327-22692349 GGGGAAATGTCCTTCCTTCGTGG + Intergenic
1189112280 X:38304086-38304108 TGTGGTATCTCCTTCATGCAGGG - Intronic
1190047386 X:47123627-47123649 TGGGGACTGGCTTTGCTGCAGGG - Intergenic
1190371752 X:49749261-49749283 TGGGCAATGTCCTTCCTGGCAGG + Intergenic
1196160983 X:112482014-112482036 TGGGGAATGGACTTCTTGGAAGG + Intergenic
1198415072 X:136411739-136411761 TGGGGAATGTGCTTCCAGGAAGG + Intronic