ID: 927558726

View in Genome Browser
Species Human (GRCh38)
Location 2:24053895-24053917
Sequence TTGGGGAATGTCCTTCCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927558726_927558732 -3 Left 927558726 2:24053895-24053917 CCTGCAGGAAGGACATTCCCCAA 0: 1
1: 0
2: 1
3: 10
4: 180
Right 927558732 2:24053915-24053937 CAAGAAGGGCCAAACGTGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 90
927558726_927558734 10 Left 927558726 2:24053895-24053917 CCTGCAGGAAGGACATTCCCCAA 0: 1
1: 0
2: 1
3: 10
4: 180
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927558726 Original CRISPR TTGGGGAATGTCCTTCCTGC AGG (reversed) Exonic
900627228 1:3613990-3614012 AGGGGATATGTCCTTCCTGCTGG + Intergenic
902540170 1:17149084-17149106 CTGGGGAAGTTCCTTCCCGCTGG + Intergenic
902766808 1:18622119-18622141 TTAGGGAGTGTGCTTCCTTCCGG + Intergenic
907091570 1:51729968-51729990 TTGGCGAATGGCTTTCTTGCTGG + Intronic
907552667 1:55317517-55317539 ATGGGGGATGTCCTTCCCACTGG + Intergenic
910123592 1:83816956-83816978 ATGGGGAAACACCTTCCTGCAGG + Intergenic
915994187 1:160547488-160547510 TTGGAAAATGTTCTTTCTGCAGG - Intronic
916559634 1:165923226-165923248 TTAGGGCATGTGCTTCCTGAAGG + Intergenic
917975285 1:180234013-180234035 TTGTTGACTGTCCTTCTTGCAGG + Intronic
918718318 1:187819852-187819874 TTGGGTAATGTGATTCCTCCAGG + Intergenic
919777117 1:201201546-201201568 TTGGAGAATTTCCTTCCTTGAGG + Intronic
921559265 1:216637424-216637446 TTAGGGAATGGTCTTCGTGCTGG - Intronic
922855428 1:228771165-228771187 TTGGGGAAAGTGCTGGCTGCCGG + Intergenic
923513476 1:234673996-234674018 TTGGGGAAGCTCCTTCCTTAGGG - Intergenic
923709807 1:236378148-236378170 TTGGGTATTTTCCTTCCTCCAGG + Intronic
1064708705 10:18099763-18099785 GTGCTGAATGTCCTTCCAGCTGG + Intergenic
1066456845 10:35579869-35579891 TTGGTTCATGTGCTTCCTGCTGG - Intergenic
1068601352 10:58960367-58960389 TTGTGGAATGTTCTTCATCCTGG + Intergenic
1068741505 10:60477914-60477936 CCTAGGAATGTCCTTCCTGCAGG - Intronic
1069082367 10:64102082-64102104 GTGGTGAAAGTCCTTCCAGCTGG + Intergenic
1070918882 10:80171733-80171755 TTAGGGAAGGTTCTTCCTGGAGG - Intronic
1071148821 10:82608709-82608731 TTGGGTATTGCCCTTCCTCCAGG + Intronic
1071199252 10:83199971-83199993 TGGGTAAATGTCCTTCCTTCTGG + Intergenic
1074697036 10:116058943-116058965 TTGGGCTCTGTCCTTCCTGGCGG + Intronic
1075485800 10:122821087-122821109 CTGGGAAGTGTCCTACCTGCTGG - Intergenic
1076468877 10:130704655-130704677 CTGGTGAGGGTCCTTCCTGCTGG - Intergenic
1077439258 11:2560436-2560458 GTGGGGGATGTCCATCCTGGGGG + Intronic
1080893113 11:36426857-36426879 GTGTGGAAAGTTCTTCCTGCTGG + Intronic
1081444434 11:43116901-43116923 ATGGGGAATGGATTTCCTGCAGG - Intergenic
1081789046 11:45769787-45769809 ATGGGGAATGACCTCCCTGTGGG + Intergenic
1082296400 11:50445534-50445556 TTAGGGCATGGCTTTCCTGCAGG - Intergenic
1084688656 11:70712059-70712081 TTGTGGAGCTTCCTTCCTGCTGG + Intronic
1085716097 11:78874927-78874949 TTGGAGAAAGCCCTTCCTGCTGG - Intronic
1086645688 11:89217364-89217386 TTGGGGAATGACCTTCCCTATGG + Intronic
1088470743 11:110185837-110185859 TTGGGGAATGAGCTGTCTGCAGG - Intronic
1090940891 11:131387433-131387455 AACGGGAATGTTCTTCCTGCAGG + Intronic
1094126906 12:27032929-27032951 GCAGGGAATGTCCTTCCTGGTGG - Intronic
1095992678 12:48047552-48047574 TTGTGGAATGTACTTCCTCCTGG + Intronic
1099373415 12:81866116-81866138 CTGGGGCATGTCTGTCCTGCAGG - Intergenic
1100267383 12:92990460-92990482 TTGGGGAATGTGAATCCTGATGG + Intergenic
1100741191 12:97595428-97595450 TCGGGGAATGTCCTACCATCCGG - Intergenic
1102478097 12:113201827-113201849 TTGGGGCAAGCCCATCCTGCAGG + Intronic
1107994990 13:45850883-45850905 TTGGCTTATTTCCTTCCTGCTGG - Intronic
1108888856 13:55227717-55227739 TTTTGGAATGCCCTTCCTGTTGG + Intergenic
1110339199 13:74369240-74369262 CTGGGGAATGTATTTCTTGCTGG + Intergenic
1111391145 13:87596489-87596511 TGGGGCAATGTTCTTCCTTCAGG + Intergenic
1111474884 13:88732026-88732048 TTTGGGATTATCCTTCCTGCTGG + Intergenic
1112187239 13:97139061-97139083 TTGGGGAATGCTCTACCTTCTGG - Intergenic
1112616744 13:101014309-101014331 TTGGGGCCTGTCCTACCTGGTGG + Intergenic
1114407922 14:22473751-22473773 TTGGGGAAAGACCTTGCTGAGGG + Intergenic
1115468408 14:33741651-33741673 TTGGGATATGTCATTTCTGCTGG + Intronic
1118603298 14:67485596-67485618 CTGGGGAGCTTCCTTCCTGCAGG + Intronic
1118808681 14:69258781-69258803 TTGAGGAGTCTGCTTCCTGCTGG - Intergenic
1118878832 14:69809095-69809117 ATGGGGAAGGTCATTGCTGCTGG + Intergenic
1121019847 14:90573234-90573256 TTGGGGAATGCTCATCCTGCAGG + Intronic
1122252286 14:100448519-100448541 TTGGGCAACTTCCTTCCTACTGG + Intronic
1123209346 14:106744445-106744467 TTGGAGAAAGTACTTCCTGTGGG + Intergenic
1124129357 15:26971104-26971126 TTGGGGAAACTCCTCCCCGCCGG + Intergenic
1124593830 15:31077563-31077585 CTGGGGAGAGCCCTTCCTGCAGG + Intronic
1126600820 15:50425465-50425487 TTGGTGAATGTCATTCATGATGG + Intronic
1126883950 15:53129795-53129817 TTGGGGAATGTTACCCCTGCAGG - Intergenic
1129508334 15:76101796-76101818 TGGGGAAATGACCTGCCTGCAGG - Intronic
1130025425 15:80267010-80267032 CTGCGGACTCTCCTTCCTGCTGG + Intergenic
1130421064 15:83747557-83747579 TTGGAGAATGTCCTTCAGCCAGG - Intronic
1132022746 15:98377171-98377193 TTGGGTAACTTCCTTCCTCCAGG - Intergenic
1132337972 15:101060971-101060993 CTGGCGAATGCCCTTCCTGCGGG + Intronic
1134252099 16:12581541-12581563 CTGGAAAATGACCTTCCTGCTGG + Intergenic
1143667372 17:8371840-8371862 TTGGGGTATCTCTTTTCTGCAGG - Exonic
1144293492 17:13850692-13850714 ATGGGGTATGTCCTTACTGGAGG - Intergenic
1144706318 17:17370776-17370798 CTGGGGAATCTCCCTCATGCTGG + Intergenic
1145011584 17:19371417-19371439 TTGGCGAGATTCCTTCCTGCAGG + Intronic
1148100542 17:45087907-45087929 TTAGGCAATGCCCATCCTGCAGG - Intronic
1149528811 17:57378808-57378830 TTGGGGCAAGTCCTTCCTCATGG - Intronic
1149684054 17:58525355-58525377 TTGGGAAATGTACTCCTTGCTGG - Intronic
1149814926 17:59714192-59714214 TTGGGTAAGGGCCTTCTTGCTGG + Intronic
1151585042 17:75003717-75003739 GCGGGGCATGTCCATCCTGCGGG + Exonic
1155011928 18:21787441-21787463 TTAGGGATTTTTCTTCCTGCAGG + Intronic
1155087302 18:22471022-22471044 TTGGGGAATGACTTTCCTGCAGG + Intergenic
1155645969 18:28078092-28078114 TTGTAAAATGTCCTTCATGCAGG + Intronic
1155970483 18:32078418-32078440 TAGGTGAATATCCTTCCTGTAGG + Intergenic
1156352940 18:36316408-36316430 TTGGGCAATGCCCTTTTTGCTGG - Intronic
1156978310 18:43253164-43253186 TTTGGGAATTTCCTGACTGCAGG + Intergenic
1157053569 18:44198448-44198470 CTGGGGCATGTCTGTCCTGCAGG + Intergenic
1157470294 18:47983195-47983217 TTGGGGATTGTGGTTTCTGCTGG - Intergenic
1157501437 18:48193674-48193696 CTGGTGAGTGTCCATCCTGCTGG - Intronic
1158872710 18:61703829-61703851 TTGTAGAATGTCCCTCCTACTGG - Intergenic
1159210067 18:65307697-65307719 TTGGGGAGTGCCATTCCTGCAGG - Intergenic
1159474622 18:68904345-68904367 TTGAAGAATGTCCTGCTTGCAGG + Intronic
1161899772 19:7109773-7109795 TATGGGAATGTCCATCCTGAAGG + Intergenic
1163102558 19:15107303-15107325 TCCCGGAATGTGCTTCCTGCTGG + Intergenic
1164506403 19:28864778-28864800 GTGGGGAATGACCTTCTGGCTGG + Intergenic
1165640541 19:37382075-37382097 TTTGGGCACGTCCTTCCTTCTGG + Intronic
1166255731 19:41602965-41602987 CTGGGGAATGGCCAGCCTGCAGG - Intronic
1166741017 19:45114873-45114895 TTTGGGAAGCTCCTTCCAGCTGG + Intronic
927096241 2:19749672-19749694 TTGGGAAACATCCGTCCTGCAGG - Intergenic
927558726 2:24053895-24053917 TTGGGGAATGTCCTTCCTGCAGG - Exonic
927910407 2:26893895-26893917 TGGCGTAATCTCCTTCCTGCTGG + Intronic
929735123 2:44539717-44539739 TTGTTGAATGTCCTTCATTCTGG + Intronic
929969043 2:46557734-46557756 GTGGGAAATGTCTTTTCTGCAGG - Intronic
930703579 2:54483462-54483484 TTGGAGATTGTTCCTCCTGCAGG + Intronic
934575458 2:95397808-95397830 CTGTGGGATGTCCATCCTGCAGG - Intergenic
939273451 2:139969996-139970018 TTGAAGAATGTCGTTCCTTCAGG - Intergenic
941714720 2:168751769-168751791 TTGTGGAAGGTCTTTCTTGCTGG - Intronic
1169369766 20:5019805-5019827 TTGGGGAAAGGACTACCTGCGGG - Intergenic
1169385637 20:5147085-5147107 CTGGGAAATGTCCCTCCTGAGGG + Intronic
1170309423 20:14976015-14976037 TTGGGGAATATCCTCTATGCTGG - Intronic
1170586878 20:17741447-17741469 CTGAGGAATGAACTTCCTGCAGG - Intergenic
1170784935 20:19459770-19459792 TTGGGGAATCTTCCTTCTGCTGG + Intronic
1171167356 20:22983779-22983801 TTGTGGAATGTCCCTCCTTTTGG + Intergenic
1172266061 20:33615339-33615361 TTGGAGAATGTACTTTCTGGAGG + Intronic
1172886849 20:38237087-38237109 TAGGTGAATGACCTTCCTTCTGG + Intronic
1173681431 20:44885364-44885386 ATGGGGATTGCCCTTTCTGCTGG - Intergenic
1174676861 20:52366374-52366396 TTGGGGAATATACTTCCTAAAGG + Intergenic
1179778585 21:43684593-43684615 GTGGGGCGTGTTCTTCCTGCTGG - Exonic
1180917431 22:19498977-19498999 CTGGGGAATGTCCTGCCAGTGGG - Intronic
1180959875 22:19757680-19757702 CACGGGACTGTCCTTCCTGCAGG + Intronic
1181031952 22:20152594-20152616 CTGGGGACTGTCCTCCCTGCAGG + Intergenic
1181859895 22:25810075-25810097 TTGGGGTATACCCTTCCTTCAGG + Intronic
1182393292 22:30017553-30017575 ATGGTGATTGTCCATCCTGCTGG - Intronic
950685355 3:14613750-14613772 CTAGGGCCTGTCCTTCCTGCTGG - Intergenic
952609753 3:35194005-35194027 TTGGGGAATCTTCTTTCTACAGG + Intergenic
952673599 3:36000328-36000350 ATGGGGAAGGTCCTCCCAGCTGG - Intergenic
953091027 3:39726242-39726264 TTGGGGAATGTGCTTCTGCCTGG + Intergenic
953664320 3:44915192-44915214 TTGGGCAGTGTCCTTCCTTATGG - Intergenic
954979927 3:54736536-54736558 TTGGGAAATATCCTTTCGGCTGG - Intronic
955284860 3:57630460-57630482 TTGGGTCATTTCCTTCCTCCGGG + Exonic
955660366 3:61292509-61292531 TTGGGGAAGACCCTTTCTGCAGG + Intergenic
956519984 3:70093599-70093621 TTTAGTAATGTCCTTCCAGCTGG + Intergenic
961022777 3:123523156-123523178 TTGGGGTTTTTCCTCCCTGCTGG - Intronic
962625661 3:137223477-137223499 ATGGGGAATGTCCTGGCAGCAGG + Intergenic
963289970 3:143477568-143477590 TTGGGGGATGCCCCTCCTACAGG - Intronic
965835660 3:172849129-172849151 TTGTGAAATGTCTTTCCTCCAGG - Intergenic
965967428 3:174510253-174510275 TTGGGAAATGTCCTTCCTCTTGG + Intronic
969989992 4:11252517-11252539 TTGAGGAGTGTCCATCCTGGGGG - Intergenic
974049013 4:56922734-56922756 CTGTAGAATGTCCTTCCTTCTGG + Intronic
977004673 4:91550065-91550087 TTGGGTATTTTCCTTCCTCCAGG + Intronic
979193361 4:117890698-117890720 TTGGGAAACGTAATTCCTGCTGG - Intergenic
980873273 4:138634492-138634514 TTGTGGGATGTCATTCCTCCAGG + Intergenic
988282632 5:29170109-29170131 TTGGGAATGCTCCTTCCTGCTGG + Intergenic
990100164 5:52174015-52174037 TTGTGGAATGTCTTTTCAGCTGG + Intergenic
992551908 5:77867023-77867045 ATGTGGAATGTCCTTACTGATGG - Intronic
993004490 5:82415808-82415830 TTCCAGAATGCCCTTCCTGCAGG - Intergenic
994020349 5:95016579-95016601 CTGGGGACTCTCCTTCCTCCTGG + Intronic
994770154 5:103971801-103971823 TTGGGTAATTCCCTTCCTTCAGG - Intergenic
995687691 5:114788869-114788891 TTGGTAAATGTCCTTCCTTGAGG - Intergenic
996021174 5:118592318-118592340 TTGGGAAATGTCCTTTCTTGTGG + Intergenic
996024161 5:118625158-118625180 TGAGGGAATATCCCTCCTGCAGG + Intergenic
999171517 5:149599234-149599256 TGGGCGTATGTCCTCCCTGCTGG - Intronic
999405476 5:151303242-151303264 TCAGAGAATGTCCATCCTGCTGG - Exonic
1001428693 5:171642685-171642707 TGGTGGAATGTCCTTCCACCGGG - Intergenic
1002423553 5:179163021-179163043 TTGGGGCATGTCTTTCTGGCTGG - Intronic
1003138715 6:3454664-3454686 ATGGGGAAGGTCCTTCTAGCTGG - Intronic
1006059928 6:31412090-31412112 TGGGGGGATGTCCTGCCTGATGG + Exonic
1006072416 6:31507165-31507187 TGGGGGGATGTCCTGCCTGATGG + Exonic
1006084405 6:31586280-31586302 TTGGAGTCTGTCCATCCTGCAGG + Intronic
1007094061 6:39202562-39202584 ACTGGGACTGTCCTTCCTGCAGG + Intronic
1009515679 6:64613934-64613956 TTGGGTATTTCCCTTCCTGCAGG - Intronic
1012181719 6:96162903-96162925 TTAGGGAATGCCTTTCCTGTAGG + Intronic
1012855899 6:104501357-104501379 TTGGGAAATCTCCCTGCTGCAGG - Intergenic
1015090192 6:129346934-129346956 GAGGGGACTGTTCTTCCTGCAGG - Intronic
1018978376 6:168582747-168582769 TTGGAGCATGTCCGACCTGCCGG + Intronic
1020501918 7:8933946-8933968 CTGAGTGATGTCCTTCCTGCTGG + Intergenic
1024211328 7:47208188-47208210 TTGGTGAATTTCCAGCCTGCTGG - Intergenic
1024553283 7:50581558-50581580 TTAGGGCATGGCTTTCCTGCAGG - Intergenic
1032704844 7:134412815-134412837 TTGGGAACTGGACTTCCTGCTGG + Intergenic
1033491257 7:141845924-141845946 TTGGGGAATGTCCATGTGGCAGG + Intergenic
1034948088 7:155277019-155277041 GTGCGGACTGTCCTCCCTGCTGG - Intergenic
1035722803 8:1804917-1804939 TTGGTAAATTTCCTTCCTGTTGG + Intergenic
1039073167 8:33664292-33664314 TTGGGAAATAGTCTTCCTGCAGG + Intergenic
1039810840 8:41047076-41047098 TTCTGGAAGGTCCTACCTGCAGG + Intergenic
1040071781 8:43194626-43194648 TTGGGGCATGTCCTTCAGGGGGG + Intronic
1041184201 8:55281954-55281976 TTGGCTTATGTGCTTCCTGCTGG + Intronic
1044266387 8:90186829-90186851 CTGGGAAATGTCCTTGCTCCTGG + Intergenic
1046420755 8:113980328-113980350 CTGGGGAATGCCTGTCCTGCAGG + Intergenic
1047886817 8:129260422-129260444 TTGGGTATTTCCCTTCCTGCTGG + Intergenic
1048809144 8:138269411-138269433 TTTGGGAATCTCCTACATGCAGG - Intronic
1049350006 8:142159362-142159384 TGGGGGCATGTCAGTCCTGCTGG - Intergenic
1049933130 9:475190-475212 TTGGTAAATGACCTTCCTGTAGG + Intronic
1050400109 9:5244305-5244327 TTGTGGACTGGCCTTCCAGCCGG - Intergenic
1053556090 9:39138409-39138431 GTGGGTAATTTCCTTCCTCCAGG + Intronic
1053820209 9:41958662-41958684 GTGGGTAATTTCCTTCCTCCAGG + Intronic
1054110483 9:61102361-61102383 GTGGGTAATTTCCTTCCTCCAGG + Intergenic
1054610374 9:67228764-67228786 GTGGGTAATTTCCTTCCTCCAGG - Intergenic
1056506846 9:87265687-87265709 TGGGAGAACTTCCTTCCTGCTGG - Intergenic
1058426878 9:104883079-104883101 TTTGCGCATGTCCTTCATGCTGG + Exonic
1060870517 9:127036181-127036203 CTGGGAAATGGTCTTCCTGCTGG + Intronic
1186178871 X:6953670-6953692 TTAGGGAATGTTCTTGCTGCAGG - Intergenic
1187601193 X:20832454-20832476 TTGGGCACTGTCCCTCCTGCTGG - Intergenic
1191150285 X:57213758-57213780 TTGGAGAATGTCCCACGTGCTGG + Intergenic
1198030806 X:132751755-132751777 TTGGAGTGTGTCCTTCGTGCTGG - Intronic
1198921770 X:141736992-141737014 TTGGAAAATATCCTTGCTGCTGG - Intergenic
1201349489 Y:13023875-13023897 CTGGGGCATGTCTGTCCTGCAGG - Intergenic