ID: 927558729

View in Genome Browser
Species Human (GRCh38)
Location 2:24053912-24053934
Sequence CACACGTTTGGCCCTTCTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927558729_927558734 -7 Left 927558729 2:24053912-24053934 CCCCAAGAAGGGCCAAACGTGTG 0: 1
1: 0
2: 0
3: 2
4: 77
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927558729 Original CRISPR CACACGTTTGGCCCTTCTTG GGG (reversed) Exonic
900417683 1:2542651-2542673 CAGGTGTTTGGCCCTTCCTGTGG + Intergenic
902280291 1:15369424-15369446 CACACGTCTGGGTCTTCTTCCGG - Exonic
903349363 1:22709123-22709145 CCCAAGCTTGGCCCATCTTGAGG - Intergenic
909126834 1:71683224-71683246 TACAGGTATGGCCCTTCGTGGGG + Intronic
910323261 1:85974314-85974336 AACACATATGGCCTTTCTTGTGG - Intronic
912661817 1:111538501-111538523 CCCACATCTGGCCCTTCATGGGG + Intronic
916818005 1:168372064-168372086 CACCCATTTGTCCCTTCTTCTGG - Intergenic
918169716 1:181985147-181985169 TACACGTATGTCCCTTCTTTTGG + Intergenic
921158887 1:212458964-212458986 CACATGTATGGCCCTCCTCGAGG + Intergenic
1064868611 10:19911070-19911092 CAAAAGTTTGGACCTTCTCGGGG + Intronic
1066841084 10:39918342-39918364 CACATATTTGGACCTTTTTGAGG + Intergenic
1067694915 10:48527823-48527845 CCCACCTCTGGCCCTTCTTCTGG - Intronic
1068114063 10:52717095-52717117 CAGACATCTGGCCCTACTTGAGG + Intergenic
1068592822 10:58867519-58867541 CTCACCTTTGGCCCTTCTCAAGG + Intergenic
1070279631 10:75038986-75039008 AACACTTTTGTTCCTTCTTGTGG + Intronic
1077362797 11:2148137-2148159 CACACGAATGGCCCGCCTTGAGG + Intronic
1081311394 11:41578331-41578353 CATACCTTTGGCTCTTCTTACGG - Intergenic
1081812261 11:45920698-45920720 CACAATGTTGGCCCTTCTTCTGG - Intergenic
1083974291 11:66104987-66105009 CACACATTTGGAGTTTCTTGGGG + Intronic
1086463080 11:87025037-87025059 GCCACTTTTGCCCCTTCTTGAGG - Intergenic
1089692313 11:120194430-120194452 CACAGTTATGGCCCTTCTTGAGG - Intergenic
1091208950 11:133840727-133840749 CCCAGGTCTGGCCCTTCTTCAGG + Exonic
1102350494 12:112188403-112188425 CAAACGTGTGGTCCATCTTGTGG - Intronic
1108185271 13:47882310-47882332 CTCATGTTTGGCCCTGCATGTGG + Intergenic
1108484788 13:50912482-50912504 CTCATGTTTGGCCCTCTTTGTGG + Intronic
1114589316 14:23845351-23845373 CACACGCTGGGGCCTACTTGAGG - Intergenic
1115648105 14:35384187-35384209 GACCCCTTTGGCCCTCCTTGAGG - Intergenic
1117620560 14:57582047-57582069 CAAACATTTGGCCCTTTTGGAGG + Intronic
1118613481 14:67559515-67559537 CGCACACTTGGCCTTTCTTGGGG + Intronic
1122937077 14:104964942-104964964 GACAAGTTTGGTTCTTCTTGTGG - Intronic
1125388370 15:39164051-39164073 CACCCATTTGGCCCTGCTGGAGG + Intergenic
1143839615 17:9721494-9721516 CACACATTAGTCCCTTTTTGTGG + Intronic
1147000288 17:37357836-37357858 CTCATATTTGTCCCTTCTTGAGG - Intronic
1148359389 17:46999330-46999352 CACACATTGAGCCCTTCTGGTGG - Intronic
1150448194 17:65243929-65243951 CACACCCTTGTCCCTTGTTGTGG + Intergenic
1151178629 17:72309733-72309755 CTCATGGTTGGCCCTTCATGTGG - Intergenic
1163177618 19:15575569-15575591 CACAAGCTTGGTCCTCCTTGGGG + Intergenic
927558729 2:24053912-24053934 CACACGTTTGGCCCTTCTTGGGG - Exonic
931811144 2:65856322-65856344 CCCACGTTTGGCCTCTGTTGTGG - Intergenic
935047562 2:99495759-99495781 CAAACTTTGGGCACTTCTTGGGG - Intergenic
943650139 2:190448920-190448942 CACACATTTGGCTCTTCTACAGG - Intronic
946322685 2:218962752-218962774 CCCTTGTTTGCCCCTTCTTGGGG - Intergenic
948595167 2:239075336-239075358 GTCACTTTTGGCCTTTCTTGGGG + Intronic
1173969751 20:47143295-47143317 CACAGTTTTGGGCCTTTTTGGGG - Intronic
1181639281 22:24188310-24188332 CTCACGTGTTGCCCTTCCTGCGG - Exonic
1182946702 22:34330964-34330986 CAGACGGTTGGCCCTACTTTGGG - Intergenic
953798131 3:46001131-46001153 CAAACTTTTCTCCCTTCTTGAGG - Intergenic
954763172 3:52891856-52891878 CACATGTTAGGCCCTCCTTGGGG - Intronic
958009141 3:87853234-87853256 CACACACTGGGCCCTACTTGAGG - Intergenic
965614525 3:170579984-170580006 CACACTTCTAGCCCTTCTCGGGG - Intronic
965686282 3:171306193-171306215 CACACATTAGGGCCTACTTGAGG + Intronic
968589749 4:1451438-1451460 TCCACGTTTGGCACTGCTTGGGG + Intergenic
968650112 4:1757102-1757124 CACTCGCTTGGGCCATCTTGGGG - Intergenic
981238625 4:142448248-142448270 CACACCTATGGCCCTTGTTTTGG + Intronic
981388371 4:144158238-144158260 CACACGTTGGGGTCTCCTTGTGG - Intergenic
994309695 5:98254415-98254437 CAAACACTTGGGCCTTCTTGAGG - Intergenic
1006391615 6:33762036-33762058 CACACGAGTGACCCTTCTGGGGG + Intergenic
1006621932 6:35371369-35371391 CACGCGCTTGTCCCTTCCTGTGG + Intronic
1007729244 6:43935885-43935907 CACTCTTTTGGCCCCTTTTGTGG + Intergenic
1020974722 7:14990653-14990675 CACACGATTGACCCTGTTTGCGG + Intergenic
1021202992 7:17746326-17746348 GACACTTTTATCCCTTCTTGAGG - Intergenic
1034740973 7:153472969-153472991 CAGACATTTGGTCATTCTTGTGG + Intergenic
1042185789 8:66135199-66135221 CACACCTTAGGGCCTTCCTGGGG + Intronic
1042808096 8:72793810-72793832 GAAACATTTGGCCCTTTTTGTGG - Intronic
1042867685 8:73370005-73370027 CCCACGTTAGTCTCTTCTTGGGG - Intergenic
1045987961 8:108271755-108271777 CACAAGTTTGGCCATTTTTCTGG - Intronic
1047162975 8:122402297-122402319 CACACACTGGGCTCTTCTTGAGG + Intergenic
1047257565 8:123227125-123227147 CAAAGATTTGGCCCTGCTTGGGG - Intronic
1047389474 8:124438436-124438458 CCCACATTTGGCCCTGCTGGAGG + Intergenic
1056307913 9:85309040-85309062 CACACACTGGGCCCTACTTGAGG - Intergenic
1057923935 9:99125917-99125939 AACAAGCTTGGCCCTTCCTGAGG + Intronic
1059556620 9:115287202-115287224 CATACGATTGGTCCTCCTTGTGG - Intronic
1060221227 9:121765084-121765106 CACATTTGTGGCCCATCTTGAGG - Intronic
1061683175 9:132254019-132254041 CACACGTATGGGCATTGTTGAGG - Intergenic
1062551200 9:137087346-137087368 CGCACATTTGCCCCTTTTTGCGG - Intronic
1062637678 9:137500188-137500210 CTGACGTGTGTCCCTTCTTGGGG - Intronic
1185928289 X:4171607-4171629 CACACGTTTGCTCTTTCTTATGG - Intergenic
1186779177 X:12896073-12896095 CATACTTTTGGAACTTCTTGTGG - Intergenic
1194130859 X:90080057-90080079 CACACTTTCAGCCCTTCTGGAGG + Intergenic
1201916909 Y:19191682-19191704 CACACGTGTGACCTTACTTGGGG + Intergenic