ID: 927558730

View in Genome Browser
Species Human (GRCh38)
Location 2:24053913-24053935
Sequence ACACACGTTTGGCCCTTCTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927558730_927558734 -8 Left 927558730 2:24053913-24053935 CCCAAGAAGGGCCAAACGTGTGT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927558730 Original CRISPR ACACACGTTTGGCCCTTCTT GGG (reversed) Exonic
903255035 1:22091485-22091507 ACACACCTGCGGCTCTTCTTCGG - Exonic
905887516 1:41499416-41499438 ACCCAGGTGTGGCCCTTCTCAGG + Intergenic
911257838 1:95652407-95652429 ACACACGTCTGGCCCTAATGTGG - Intergenic
912853723 1:113148872-113148894 ACACAAGTGTGGCTCTTTTTAGG - Intergenic
914325153 1:146606464-146606486 ACACATCTCTGGGCCTTCTTTGG + Intergenic
919420879 1:197368984-197369006 ACAAACGTTTGGCTATTCTCAGG - Intronic
920496525 1:206458772-206458794 ACACTTATCTGGCCCTTCTTTGG - Exonic
1062834905 10:629178-629200 ACACACGGTTGGCCCTGCACAGG + Intronic
1063249080 10:4254129-4254151 ACCCATTTTTGTCCCTTCTTGGG + Intergenic
1064094678 10:12414945-12414967 ACACTCGTTTGGAATTTCTTCGG + Intronic
1065355271 10:24834592-24834614 ACACAAGTTTTCTCCTTCTTGGG - Intergenic
1067299940 10:44998964-44998986 ACATACCTCTGGCCCTTCTATGG + Exonic
1072790583 10:98314825-98314847 ACACAGGCTTGGCCCTGCCTTGG + Intergenic
1082312650 11:50672071-50672093 ACACAGTTTTGGTCCTTCCTTGG - Intergenic
1083924507 11:65797855-65797877 ACACAGGTGTGGCCATCCTTAGG - Intergenic
1083974290 11:66104986-66105008 ACACACATTTGGAGTTTCTTGGG + Intronic
1086365001 11:86100372-86100394 ATATACCTTTGGCCCTACTTAGG + Intergenic
1088754683 11:112876130-112876152 ACACACATTTGTCCCTTGCTGGG + Intergenic
1095786128 12:46110397-46110419 ACACAAGTTTCCTCCTTCTTAGG - Intergenic
1103061465 12:117861917-117861939 ACACAGGTATTGCCTTTCTTTGG - Intronic
1105867126 13:24470999-24471021 ACGCACGTTTGCCTCCTCTTGGG - Intronic
1112565755 13:100550350-100550372 ACACACCACTGGCCCTTCTAAGG + Intronic
1114653062 14:24299075-24299097 ACACACACTTGGCCATTCATGGG + Exonic
1115024873 14:28732348-28732370 ACAAAAGTTTGGCACATCTTGGG - Intergenic
1118613480 14:67559514-67559536 ACGCACACTTGGCCTTTCTTGGG + Intronic
1118725475 14:68625810-68625832 ACACAGTTTTAGCTCTTCTTTGG + Intronic
1125215231 15:37264371-37264393 ACACACGTTTGGTTCTACTTAGG + Intergenic
1127756064 15:62093380-62093402 ACACAGGATGTGCCCTTCTTAGG - Intergenic
1128169957 15:65502877-65502899 ATACACGTCTTGCTCTTCTTTGG - Intronic
1137757713 16:50915778-50915800 CCACCCTTTTGGCCCATCTTTGG + Intergenic
1140008412 16:71104483-71104505 ACACATCTCTGGGCCTTCTTTGG - Intronic
927087108 2:19683116-19683138 ACACACCTTGGGCACTTCCTAGG + Intergenic
927558730 2:24053913-24053935 ACACACGTTTGGCCCTTCTTGGG - Exonic
927922825 2:26986655-26986677 ACTCACCTTTGGTCCTTCTCAGG + Intronic
932691183 2:73914998-73915020 ATACATTTTTGGCCCTTCCTAGG - Intronic
933783375 2:85817771-85817793 ACACACCTGTGGCCGTACTTTGG - Intergenic
935952819 2:108346290-108346312 TCACAGGTTTGGCTCTCCTTTGG + Intergenic
939253279 2:139711118-139711140 ACACTTGTTGAGCCCTTCTTAGG + Intergenic
1169764242 20:9131532-9131554 ATACACGTTAGTCCCTTCCTGGG - Intronic
1172854768 20:37993423-37993445 ACACTGGTTTGGTCATTCTTTGG + Intronic
1177114738 21:17072320-17072342 ACACACATTTTGCCTTACTTAGG + Intergenic
1182946703 22:34330965-34330987 CCAGACGGTTGGCCCTACTTTGG - Intergenic
950201489 3:11047838-11047860 ACACACCTTTGGCTCCTCTAGGG - Intergenic
953223475 3:40996320-40996342 ACACAGTTTTGGCTCTTTTTTGG - Intergenic
954763173 3:52891857-52891879 GCACATGTTAGGCCCTCCTTGGG - Intronic
957605562 3:82394480-82394502 TCACACCCTTGGCCTTTCTTAGG - Intergenic
959140018 3:102474391-102474413 ATACTTGTTTGTCCCTTCTTGGG + Intronic
961724975 3:128921913-128921935 ACACCCGTGGGGACCTTCTTTGG - Intronic
962989442 3:140565158-140565180 TCACAAGGTTGGCCCTTGTTAGG - Intronic
970805633 4:20027586-20027608 AAAGAAGTTTGTCCCTTCTTGGG - Intergenic
970878631 4:20902176-20902198 ATACAAGTCTGGCCCTTCTAGGG + Intronic
974856281 4:67465520-67465542 ACACAGGTTTCTCCCTTCCTTGG - Intergenic
975111561 4:70634311-70634333 GCACACCTGGGGCCCTTCTTTGG + Exonic
977540345 4:98311510-98311532 ACACACGATGGGACCTTCATAGG - Intronic
986058552 5:4164199-4164221 ACACACAATTGGCCCATGTTGGG + Intergenic
992428378 5:76682575-76682597 ACTCATCTTTGGGCCTTCTTAGG + Intronic
1006104851 6:31710397-31710419 ACATCCATTTGGCCCGTCTTGGG + Exonic
1007479195 6:42138879-42138901 ACACTCGTGTGGCCTTGCTTGGG + Intronic
1028974781 7:96900409-96900431 ATAAAGGTTTAGCCCTTCTTAGG - Intergenic
1029212614 7:98921303-98921325 ACACACCGTTCTCCCTTCTTTGG - Intronic
1033791256 7:144795017-144795039 ACATATGTGTGGGCCTTCTTTGG - Intronic
1035096278 7:156358590-156358612 ACACACATTTGGCACATGTTTGG - Intergenic
1035934370 8:3820379-3820401 ACTCACTTTTAGTCCTTCTTTGG - Intronic
1048113665 8:131496043-131496065 ATACATTTTTGGCCCTTTTTTGG - Intergenic
1060662380 9:125411840-125411862 ACACAGGTTTGGCCCTTTCAGGG - Intergenic
1062637679 9:137500189-137500211 ACTGACGTGTGTCCCTTCTTGGG - Intronic
1189712130 X:43824368-43824390 AAAGAGGTTTGGCCCTTCATAGG + Intronic
1192554263 X:72077569-72077591 ACTCAGGTTTGGGCGTTCTTTGG - Intergenic
1195146692 X:102025825-102025847 TCACTGTTTTGGCCCTTCTTTGG - Intergenic
1196362588 X:114882048-114882070 ACACAAGTTTTGCATTTCTTTGG + Intronic
1197865136 X:131009479-131009501 ACACACATTTTGCCCTTGTGGGG + Intergenic