ID: 927558731

View in Genome Browser
Species Human (GRCh38)
Location 2:24053914-24053936
Sequence CACACACGTTTGGCCCTTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927558731_927558734 -9 Left 927558731 2:24053914-24053936 CCAAGAAGGGCCAAACGTGTGTG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927558731 Original CRISPR CACACACGTTTGGCCCTTCT TGG (reversed) Exonic
902641386 1:17768489-17768511 CTCACATGTGTGGCTCTTCTAGG - Intronic
904357400 1:29949449-29949471 CACACACGAATGTCCCTGCTTGG - Intergenic
905728672 1:40278056-40278078 CAAACATGTTTGGCTCTTCCTGG + Intronic
906703769 1:47879772-47879794 CTCTCACTTCTGGCCCTTCTTGG - Intronic
912042376 1:105408616-105408638 CACAAACTTTTGGTACTTCTGGG - Intergenic
913517945 1:119621134-119621156 AGGACATGTTTGGCCCTTCTAGG + Exonic
918261839 1:182803341-182803363 CACACATCTTTTGCCCTTTTAGG - Intronic
919145044 1:193623388-193623410 CACACACACTTGTCACTTCTAGG - Intergenic
920720910 1:208386039-208386061 CTTACACTTTTGGCTCTTCTGGG + Intergenic
1064868609 10:19911068-19911090 CTCAAAAGTTTGGACCTTCTCGG + Intronic
1065201150 10:23314329-23314351 CACACACGTTTGGCCAGGCACGG + Intronic
1065355272 10:24834593-24834615 CACACAAGTTTTCTCCTTCTTGG - Intergenic
1070649563 10:78225189-78225211 CACAACCCTTTGGTCCTTCTTGG + Intergenic
1074785914 10:116839835-116839857 CACACACGTCTGTACCCTCTGGG - Intergenic
1074792353 10:116903202-116903224 CAGACACGTTTGGACATTATTGG + Intronic
1076783927 10:132739669-132739691 CACACACGTGTGCAGCTTCTTGG - Intronic
1077227782 11:1445892-1445914 CACACACCTCTGGCCGTGCTGGG - Exonic
1077291152 11:1794620-1794642 CAGTTATGTTTGGCCCTTCTAGG + Intergenic
1090344639 11:126059763-126059785 CACACACATGTGGCTCTTTTAGG + Intronic
1094491355 12:30962917-30962939 CACACACATTATGCCCTTCTGGG + Intronic
1106259814 13:28056492-28056514 CAGACACCTTTAGTCCTTCTTGG + Intronic
1107462371 13:40616522-40616544 CACATGCGTTTGGCCCTCCATGG - Intronic
1114653061 14:24299074-24299096 CACACACACTTGGCCATTCATGG + Exonic
1115465444 14:33709629-33709651 CACACAGGGTTGGCCCTTGTGGG - Intronic
1118613479 14:67559513-67559535 CACGCACACTTGGCCTTTCTTGG + Intronic
1118664949 14:68058272-68058294 CACATACCTTTGACCCTTTTTGG + Intronic
1121103854 14:91267960-91267982 GATACAAGTTTGGGCCTTCTGGG + Intergenic
1127473312 15:59309676-59309698 GACACACATTTGGCCTTTCTGGG - Intronic
1132113409 15:99118576-99118598 CCCAGATCTTTGGCCCTTCTAGG + Intronic
1133201839 16:4208535-4208557 CACAAGCATTTGTCCCTTCTTGG - Intronic
1135418322 16:22286628-22286650 CACAAACGGGTGGCCCTTTTGGG + Exonic
1135927958 16:26711797-26711819 CACACCCGCCTGGCCCCTCTAGG + Intergenic
1137564038 16:49522171-49522193 CACACCAGTTTGGCCCTCCAGGG - Intronic
1140817126 16:78631662-78631684 CACACACGTGTAGCCCTACTTGG - Intronic
1145897080 17:28465389-28465411 CACACACATTTGGCACATCCTGG - Intronic
1148470346 17:47889258-47889280 CACACACATTTGCCTCTTCAAGG - Intergenic
1156275131 18:35576926-35576948 CACACACGTTTAGCACTTTGAGG - Intergenic
1160865741 19:1255212-1255234 CACACACGCCTGGCCCTGCCCGG + Intronic
1163424491 19:17233861-17233883 CTCACACCGTAGGCCCTTCTGGG - Intronic
1163764213 19:19153395-19153417 CACAGAGGTTGGGCCATTCTAGG + Intronic
1167675940 19:50885657-50885679 GACACACGGTTGGCCATTCAAGG - Intergenic
1168708152 19:58481330-58481352 AACAGAGGTTTGGCCGTTCTGGG - Intronic
927558731 2:24053914-24053936 CACACACGTTTGGCCCTTCTTGG - Exonic
931450742 2:62365796-62365818 CACACACCTTTTGCACTTCCTGG + Intergenic
937677947 2:124612550-124612572 CACTCACCTTTAGCCATTCTTGG - Intronic
941423576 2:165315449-165315471 CACATACTTTGCGCCCTTCTAGG + Exonic
942553968 2:177152022-177152044 CACTCTCATTTGGACCTTCTTGG + Intergenic
948625686 2:239266563-239266585 CACACACCTTTGCTCCCTCTGGG + Intronic
1169764243 20:9131533-9131555 CATACACGTTAGTCCCTTCCTGG - Intronic
1175593413 20:60211866-60211888 CACCCACGCTGGGGCCTTCTAGG + Intergenic
1181771970 22:25132092-25132114 CAGACACATTTGTCCCTTCTTGG + Intronic
949590474 3:5489093-5489115 CACAGTCATTTGCCCCTTCTAGG + Intergenic
950201490 3:11047839-11047861 CACACACCTTTGGCTCCTCTAGG - Intergenic
950498152 3:13346807-13346829 CACACTCGCTTGGCACTTCCTGG - Intronic
954976496 3:54700007-54700029 CACACAAGGTTGTCCCTCCTGGG + Intronic
959140017 3:102474390-102474412 CATACTTGTTTGTCCCTTCTTGG + Intronic
959620509 3:108394415-108394437 CAAACACGTTTGGGGCTTGTAGG - Intronic
961483572 3:127200201-127200223 CACACACGGCTGGCCCTCCAGGG + Intergenic
962988574 3:140558179-140558201 CACACACGTGTGCCTTTTCTAGG - Intronic
963111871 3:141695005-141695027 GACAGCCTTTTGGCCCTTCTGGG + Intergenic
963889861 3:150622014-150622036 CACACAGATTTGGCCTTTTTGGG - Intronic
967277706 3:187793000-187793022 CACACACGACTTGCCCTTCCTGG + Intergenic
970878630 4:20902175-20902197 GATACAAGTCTGGCCCTTCTAGG + Intronic
983185627 4:164697272-164697294 CTCACAGGTTGGGCCCTCCTAGG - Intergenic
983612390 4:169663200-169663222 CACACACATATGGCACTCCTAGG + Intronic
985315356 4:188653440-188653462 AACACAAGTTTGGCCTTTCTGGG + Intergenic
986202150 5:5588468-5588490 CAAACACCCATGGCCCTTCTGGG - Intergenic
989106217 5:37865536-37865558 CACACACAAATGGCACTTCTGGG + Intergenic
996182162 5:120432346-120432368 CTCACAGTTTTGACCCTTCTTGG + Intergenic
999713790 5:154342654-154342676 CAAAAACGCATGGCCCTTCTAGG + Intronic
1002521967 5:179797110-179797132 CACACACTGTTGCCCCTCCTTGG - Intergenic
1005535241 6:26748992-26749014 GCCACAGGTTTGGCACTTCTAGG - Intergenic
1007479194 6:42138878-42138900 CACACTCGTGTGGCCTTGCTTGG + Intronic
1009006279 6:57792626-57792648 GCCACAGGTTTGGCACTTCTAGG - Intergenic
1010032523 6:71286389-71286411 CACACACAAGTGGCCTTTCTAGG + Intergenic
1016498347 6:144689861-144689883 CACACAAGTTTTCCCCTTCCTGG + Intronic
1019131078 6:169875494-169875516 CAGATAGGTTTGGCTCTTCTGGG + Intergenic
1021631312 7:22650196-22650218 ACCAGATGTTTGGCCCTTCTAGG + Intergenic
1022258250 7:28680455-28680477 CACAAAAGTTTGGACCTCCTTGG + Intronic
1025016366 7:55441851-55441873 CACACATGGCTGGCTCTTCTGGG + Intronic
1028416988 7:90590998-90591020 CACATACTTTTGGCATTTCTAGG + Intronic
1040695558 8:49993567-49993589 CACACACACTTGGCCTTTCGGGG - Intronic
1046137378 8:110046244-110046266 CACACACAGGTGGCCATTCTTGG + Intergenic
1060662381 9:125411841-125411863 CACACAGGTTTGGCCCTTTCAGG - Intergenic
1062637680 9:137500190-137500212 CACTGACGTGTGTCCCTTCTTGG - Intronic
1185566180 X:1097169-1097191 CACCCACGTTTCCCCCTCCTGGG - Intergenic
1190550597 X:51575984-51576006 CAACCACATTTGGCCCTGCTTGG + Intergenic
1192185470 X:68944033-68944055 CACAAACATGTGCCCCTTCTGGG - Intergenic
1192501928 X:71660230-71660252 CACACACCTTTGGCCCTAGTTGG + Intergenic
1195710914 X:107773278-107773300 CACCCAGGTTTGACCCTCCTAGG + Intronic
1197865135 X:131009478-131009500 GACACACATTTTGCCCTTGTGGG + Intergenic