ID: 927558734

View in Genome Browser
Species Human (GRCh38)
Location 2:24053928-24053950
Sequence ACGTGTGTGGTGCACTACAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 46}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927558729_927558734 -7 Left 927558729 2:24053912-24053934 CCCCAAGAAGGGCCAAACGTGTG 0: 1
1: 0
2: 0
3: 2
4: 77
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558722_927558734 22 Left 927558722 2:24053883-24053905 CCCTCATGTCTCCCTGCAGGAAG 0: 1
1: 0
2: 4
3: 41
4: 321
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558730_927558734 -8 Left 927558730 2:24053913-24053935 CCCAAGAAGGGCCAAACGTGTGT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558731_927558734 -9 Left 927558731 2:24053914-24053936 CCAAGAAGGGCCAAACGTGTGTG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558723_927558734 21 Left 927558723 2:24053884-24053906 CCTCATGTCTCCCTGCAGGAAGG 0: 1
1: 1
2: 7
3: 46
4: 296
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558726_927558734 10 Left 927558726 2:24053895-24053917 CCTGCAGGAAGGACATTCCCCAA 0: 1
1: 0
2: 1
3: 10
4: 180
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558725_927558734 11 Left 927558725 2:24053894-24053916 CCCTGCAGGAAGGACATTCCCCA 0: 1
1: 0
2: 1
3: 17
4: 175
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927558734 Original CRISPR ACGTGTGTGGTGCACTACAC AGG Exonic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
903104324 1:21062198-21062220 ACATGTGTGTGCCACTACACTGG + Intronic
905288678 1:36906200-36906222 ACATGTGTGGTGCTCCACTCAGG + Intronic
920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG + Intronic
922117535 1:222628948-222628970 CCATGAGTGGTGCACTACCCAGG - Exonic
1062871209 10:906483-906505 ACCTGTGGGTTGCACCACACTGG - Intronic
1063727693 10:8656457-8656479 ACGTGTGTCATTCACTAGACTGG + Intergenic
1071548041 10:86543519-86543541 ACATGTGTGCACCACTACACTGG - Intergenic
1078016218 11:7617326-7617348 GCGTGTGTGGGGCATTTCACTGG + Intronic
1081290570 11:41320474-41320496 ATGTCTATGGTGCATTACACTGG + Intronic
1092777036 12:11952833-11952855 ACGTGTGTGGTGCCCAGCGCTGG + Intergenic
1093088729 12:14896113-14896135 ACTTGTTTGGTGCTCTACCCGGG - Intronic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1110330107 13:74261822-74261844 ACGTGTGTGTGGTAGTACACTGG + Intergenic
1111006712 13:82258335-82258357 AGGAGTGTGGTGCACCGCACGGG + Intergenic
1113207106 13:107929789-107929811 ACATGTCTCCTGCACTACACTGG + Intergenic
1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG + Exonic
1119077976 14:71663574-71663596 ACTTGTGTGGTTCATTACAGTGG - Intronic
1132215711 15:100060275-100060297 ACTTCTGTGGGGCACCACACGGG + Intronic
1133924215 16:10180985-10181007 AAGTGTGTGGTGCACACGACGGG - Intronic
1144445089 17:15319719-15319741 ACGTGTGTGGTCCAGTAGAGAGG - Intronic
1153410691 18:4789375-4789397 ACGTGTGTGGTCCACTATCATGG - Intergenic
1156447713 18:37249457-37249479 AGGTTTGTGCTGCAGTACACAGG - Intronic
1163643031 19:18472637-18472659 ACGTGTCGGGTGCACGTCACAGG - Intronic
1164973993 19:32557729-32557751 ACTTGAATGGTTCACTACACAGG - Intergenic
1166378168 19:42340191-42340213 AAATGTGTGGAGCACTTCACTGG - Intronic
1166893750 19:46010317-46010339 ACCTGTCTGGTTCACTGCACAGG - Intronic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
931274767 2:60734767-60734789 AGGTGTGTGGTACATGACACTGG - Intergenic
931661617 2:64569611-64569633 ACGTGTGTGTAGCTCTTCACGGG + Exonic
945249604 2:207753131-207753153 AGGTGTGTGCTGGACTATACTGG - Intronic
948563326 2:238868096-238868118 ACCTTTGTGGGGCACTGCACTGG - Intronic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
954159265 3:48708793-48708815 ACGTGTGTGAGCCACCACACGGG - Intronic
955909180 3:63842764-63842786 ACTTGTGTAGTACACTACCCGGG + Intronic
963778499 3:149464029-149464051 ACCTGCGTGATGCACTACACCGG - Intergenic
965354896 3:167661834-167661856 ACATGTGTAGGGCACTACCCTGG + Intergenic
993525999 5:88966423-88966445 ATGTGAGTGGTTCACTAAACAGG + Intergenic
1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG + Exonic
1023042788 7:36186723-36186745 ACGTGGGTGGAGGAGTACACAGG + Intronic
1026152076 7:67796393-67796415 ACGTGTGTGATACACTCCCCAGG - Intergenic
1027867253 7:83663400-83663422 AGCTGTGAGGTGCACAACACAGG + Intergenic
1029243291 7:99179967-99179989 ATGTGGGTGGGGAACTACACAGG - Intronic
1035835519 8:2747627-2747649 TCATATGTGGTGCACTACAAGGG - Intergenic
1046404868 8:113760254-113760276 ATCTGTGTGGTGCTCTACAGAGG + Intergenic
1047119572 8:121885980-121886002 CCGTGTGTGGTGGAGCACACCGG + Intergenic
1048510107 8:135054574-135054596 ACGGGTGTGGGGCACCATACTGG - Intergenic
1062303742 9:135890202-135890224 ATGTGTGTGGAGCATTCCACAGG - Intronic
1199390513 X:147272392-147272414 ATGTGTGTGGTGTCCTACTCAGG - Intergenic
1199601095 X:149541496-149541518 CTGTGTGTGGAGCAGTACACGGG - Exonic