ID: 927558734

View in Genome Browser
Species Human (GRCh38)
Location 2:24053928-24053950
Sequence ACGTGTGTGGTGCACTACAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 46}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927558722_927558734 22 Left 927558722 2:24053883-24053905 CCCTCATGTCTCCCTGCAGGAAG 0: 1
1: 0
2: 4
3: 41
4: 321
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558729_927558734 -7 Left 927558729 2:24053912-24053934 CCCCAAGAAGGGCCAAACGTGTG 0: 1
1: 0
2: 0
3: 2
4: 77
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558725_927558734 11 Left 927558725 2:24053894-24053916 CCCTGCAGGAAGGACATTCCCCA 0: 1
1: 0
2: 1
3: 17
4: 175
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558730_927558734 -8 Left 927558730 2:24053913-24053935 CCCAAGAAGGGCCAAACGTGTGT 0: 1
1: 0
2: 0
3: 1
4: 69
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558731_927558734 -9 Left 927558731 2:24053914-24053936 CCAAGAAGGGCCAAACGTGTGTG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558723_927558734 21 Left 927558723 2:24053884-24053906 CCTCATGTCTCCCTGCAGGAAGG 0: 1
1: 1
2: 7
3: 46
4: 296
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46
927558726_927558734 10 Left 927558726 2:24053895-24053917 CCTGCAGGAAGGACATTCCCCAA 0: 1
1: 0
2: 1
3: 10
4: 180
Right 927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG 0: 1
1: 0
2: 2
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927558734 Original CRISPR ACGTGTGTGGTGCACTACAC AGG Exonic