ID: 927559906

View in Genome Browser
Species Human (GRCh38)
Location 2:24062737-24062759
Sequence TTCACCCTCTTCCAAAGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927559906_927559907 -9 Left 927559906 2:24062737-24062759 CCTATTCTTTGGAAGAGGGTGAA 0: 1
1: 0
2: 0
3: 16
4: 179
Right 927559907 2:24062751-24062773 GAGGGTGAACTATGAACAAATGG 0: 1
1: 0
2: 0
3: 10
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927559906 Original CRISPR TTCACCCTCTTCCAAAGAAT AGG (reversed) Intronic
900004161 1:33496-33518 TTCACCTTTTTCCAAAGTGTTGG - Intergenic
900023888 1:204014-204036 TTCACCTTTTTCCAAAGTGTTGG - Intergenic
900866887 1:5275286-5275308 TTCACCCTCTTTCAAATAAAAGG + Intergenic
901802336 1:11715496-11715518 TTCTCCCTCTTCCAGATAGTGGG - Intronic
903740814 1:25557368-25557390 TTCACCCTCTTCTTAAGTAATGG - Intronic
905425791 1:37883211-37883233 TTTTCCCTCTTCCCAGGAATGGG - Intronic
907584546 1:55605460-55605482 TTCTCCCTCTTCAAAATACTTGG + Intergenic
908309533 1:62864488-62864510 TTAACCCTCCCCCAAAGACTGGG + Exonic
910786673 1:91006488-91006510 CTCAAACTCTTCCAAAAAATAGG + Intronic
914260578 1:145995985-145996007 TTCACCCTCCAACAATGAATTGG + Intronic
915002119 1:152603165-152603187 TTCACCGTCTTCCCAGGAACAGG - Intergenic
915703782 1:157823898-157823920 CTGACCCACTTCCACAGAATGGG + Intergenic
916343710 1:163764601-163764623 CTCACTCTCTTCCACAGCATTGG + Intergenic
916502075 1:165396003-165396025 TTCACTCTCTACCAGGGAATTGG + Intergenic
916715284 1:167442448-167442470 TTCACCCTGTTCAACAGAAGAGG - Intronic
916959854 1:169878199-169878221 TTCTGCCTCTTCCTAAGAAATGG + Intronic
922655378 1:227377859-227377881 CCCAGCCACTTCCAAAGAATGGG - Intergenic
922861978 1:228826779-228826801 TTCATTCTCATCCAAATAATTGG + Intergenic
1063040013 10:2328662-2328684 TTCCCCATCTTACATAGAATTGG + Intergenic
1064893166 10:20203260-20203282 TTCTCTCTCCTCCAAATAATAGG - Intronic
1067088617 10:43255423-43255445 TGCACCCTCATCCAAAGGCTGGG + Intronic
1068642068 10:59420599-59420621 CTCAAACTCTTCCAAAAAATAGG + Intergenic
1069768561 10:70882571-70882593 CTGACCCTCTTCCAAATAAAAGG - Intronic
1070373014 10:75803400-75803422 TTCACCCTGTTACCAAGAACAGG - Intronic
1071226888 10:83540768-83540790 TTCACTCTCTTTCAAAGTATAGG + Intergenic
1076906360 10:133363896-133363918 TTGAGCCTATTCCAAATAATTGG + Intronic
1077335234 11:2000541-2000563 ATCCCCATCATCCAAAGAATGGG + Intergenic
1077335326 11:2000948-2000970 ATCCCCATCATCCAAAGAATGGG + Intergenic
1077335584 11:2002380-2002402 ATCCCCATCATCCAAAGAATGGG + Intergenic
1077949179 11:6936582-6936604 CTCAAACTCTTCCAAAAAATAGG + Intronic
1078859544 11:15234683-15234705 TTCACCCACTTTCACAGAAATGG - Intronic
1078897488 11:15609868-15609890 TTCATCCTCAGCCATAGAATGGG + Intergenic
1080054173 11:27888004-27888026 TTTACCATCTTGAAAAGAATGGG + Intergenic
1081008745 11:37781397-37781419 TTCACCCTCTTCCTAGGGATAGG - Intergenic
1081232549 11:40603605-40603627 TTCACCATATTCCGGAGAATTGG - Intronic
1081481539 11:43494245-43494267 TTCATCCTCCTCCAAAGAGAAGG - Exonic
1088714864 11:112540110-112540132 TCTACCCTCTTCCCAAGAAAAGG - Intergenic
1088921578 11:114263080-114263102 TTCACCCCCATCCCAAGCATGGG + Intronic
1202818217 11_KI270721v1_random:55723-55745 ATCCCCATCATCCAAAGAATGGG + Intergenic
1202818309 11_KI270721v1_random:56130-56152 ATCCCCATCATCCAAAGAATGGG + Intergenic
1202818568 11_KI270721v1_random:57562-57584 ATCCCCATCATCCAAAGAATGGG + Intergenic
1091377584 12:35546-35568 TTCACCTTTTTCCAAAGTGTTGG - Intergenic
1091400818 12:179598-179620 CTCACCCTCTTCCCAGGAAATGG + Intergenic
1092024747 12:5231316-5231338 TTCTGCCTCTCCCAAAGCATTGG - Intergenic
1092507590 12:9119870-9119892 TTTTCCCTCTCCTAAAGAATAGG - Intergenic
1093338985 12:17948518-17948540 TTATCCCTATTCCAATGAATAGG + Intergenic
1093815071 12:23535673-23535695 TGCAGCCTCTTCCAAGGAACTGG + Intronic
1094110130 12:26853489-26853511 CTCACCCTTTGCCACAGAATTGG - Intergenic
1095592388 12:43917844-43917866 GTCACCCTCTTGCACAGACTTGG + Intronic
1097155791 12:57011381-57011403 TTCACTAGCTTCCAAAGAATTGG - Intronic
1097606602 12:61762386-61762408 TTATTCCTTTTCCAAAGAATTGG + Intronic
1100670797 12:96810451-96810473 TTCCTCCTCTTCTAAAGATTTGG + Intronic
1102357177 12:112247907-112247929 TTTAACCTCTTTTAAAGAATGGG + Intronic
1102401128 12:112630602-112630624 TACACCCTTCTCCAAAGAATTGG - Intronic
1104758719 12:131284391-131284413 GTCACCCTCTTTCAATGACTAGG + Intergenic
1104821881 12:131682134-131682156 GTCACCCTCTTTCAATGACTAGG - Intergenic
1105221067 13:18327962-18327984 GTCACCCCATTCCAAAGCATGGG - Intergenic
1105693599 13:22865849-22865871 ACCACCAACTTCCAAAGAATTGG - Intergenic
1105991155 13:25622494-25622516 TTCACCATTTCCCAAAGTATGGG - Intronic
1106016710 13:25876199-25876221 TTCAGCCTCTTCCAAGGCAGCGG - Intronic
1108257515 13:48624880-48624902 TTCACACTCTTTCAAAGCCTGGG + Intergenic
1108507365 13:51124594-51124616 TTCACTGTCTTCCAAAGCTTAGG - Intergenic
1109006787 13:56887189-56887211 TTAACACTCTTTCAAAGATTTGG - Intergenic
1110864537 13:80379568-80379590 TTCTCCCTTCTCCAGAGAATAGG + Intergenic
1115069311 14:29301923-29301945 TTCACCATCTTCCAGGGAAATGG + Intergenic
1117257691 14:53996290-53996312 TCCATCCTCTTCCAAAGGATGGG - Intergenic
1119772883 14:77232122-77232144 CTCACCCTGTTCCAATGAGTGGG - Intronic
1121055910 14:90852562-90852584 TGCACCCTATTGTAAAGAATTGG + Exonic
1121450973 14:94008084-94008106 TTCATCTTCTTCCCAAGAAAAGG + Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1125451644 15:39814298-39814320 TTCACCCTCTTCTGAAAACTGGG + Intronic
1125920393 15:43522032-43522054 CTGACCCTCTTCCACAAAATGGG + Exonic
1132449343 15:101957446-101957468 TTCACCTTTTTCCAAAGTGTTGG + Intergenic
1133638266 16:7691251-7691273 CTCACCCTCTTCAAAAGAGTTGG - Intronic
1137569595 16:49557023-49557045 TCCCTCCTCTTCCAAATAATTGG + Intronic
1137664481 16:50241635-50241657 TTTACCTTCTTCCAGAGAAAAGG + Intergenic
1144151922 17:12456294-12456316 TTCATTCTCTTCCCAAGATTAGG + Intergenic
1147694968 17:42344920-42344942 TTCAAACTTTTCCAAAGTATAGG - Intronic
1148177480 17:45579828-45579850 TTCCCCCTCTTCTGTAGAATAGG - Intergenic
1150183733 17:63157170-63157192 TTCTGCCTCTCCCAAAGCATAGG - Intronic
1151157184 17:72133460-72133482 ATCACCCTCTTCCCCAGAGTGGG - Intergenic
1151685274 17:75642589-75642611 CTCAGCCCCCTCCAAAGAATAGG + Intronic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1153412734 18:4811701-4811723 TTCCTCCTCTTCTGAAGAATGGG - Intergenic
1155443232 18:25884033-25884055 TTTACCCTGTGCCAAAGAATAGG + Intergenic
1156606859 18:38676680-38676702 TTGACACTATTCCAAAAAATAGG - Intergenic
1157369210 18:47094843-47094865 TTTACCCTCTACCAAGGTATGGG + Intronic
1157653048 18:49356648-49356670 TTCACTCTCTTCCAACGACTTGG + Intronic
1158755785 18:60323140-60323162 TCCACCCTCCTCCAAAGCCTTGG + Intergenic
1159265927 18:66078919-66078941 GTCATCCTGTTCCAAATAATAGG - Intergenic
1159281099 18:66287198-66287220 TTCACACTCTTCCTAAGACCTGG - Intergenic
1159851829 18:73534401-73534423 TCTACCCTCTCCCAAAGACTGGG + Intergenic
1159930376 18:74306960-74306982 TTTATACTCTTCCAGAGAATTGG + Intergenic
1160635913 19:75105-75127 TTCACCTTTTTCCAAAGTGTTGG - Intergenic
1161384947 19:3986128-3986150 TTCACTCTCCCCCAAACAATAGG - Intergenic
1162043872 19:7986065-7986087 TTAACCCTCATCCAAAGAGAGGG - Intronic
1168182642 19:54672519-54672541 TTCAACCTCTACCACAGAGTAGG - Intronic
926075460 2:9939453-9939475 TTAATCCTCTTCCCAAAAATGGG + Intergenic
926862402 2:17322646-17322668 TTCAGCCTCTGCCAAAGTATGGG + Intergenic
927559906 2:24062737-24062759 TTCACCCTCTTCCAAAGAATAGG - Intronic
928026640 2:27745015-27745037 TTCACTATCTTCCTAAGAAAAGG + Intergenic
928116882 2:28551452-28551474 CTCACCCTTTTCCATAAAATAGG - Intronic
932146121 2:69318890-69318912 CTCACCCTCTTCCCAAGAAGAGG - Intergenic
933646869 2:84820221-84820243 ACCACCCTCTTACAAAGAATTGG + Intergenic
934182990 2:89644506-89644528 GTCACCCCATTCCAAAGCATGGG + Intergenic
934293276 2:91718693-91718715 GTCACCCCATTCCAAAGCATGGG + Intergenic
936565567 2:113579946-113579968 TTCACCTTTTTCCAAAGTGTTGG + Intergenic
938336594 2:130505831-130505853 TTTACCCTCTTCAGAAGAAGAGG - Intronic
938353224 2:130614831-130614853 TTTACCCTCTTCAGAAGAAGAGG + Intronic
939018131 2:136925711-136925733 CTTAAACTCTTCCAAAGAATTGG - Intronic
940719090 2:157261662-157261684 TTTATCCTCTTTCAAAGAAGAGG - Intronic
943557511 2:189423812-189423834 CTCAAACTCTTCCAAAAAATTGG + Intergenic
944312325 2:198247357-198247379 TTCACTCTCCTCTAAATAATGGG - Intronic
946115058 2:217453963-217453985 TTCTTTCTCTTCCAAATAATGGG + Intronic
946834998 2:223763866-223763888 ATCACCCTCTTCCAAATAGCAGG + Intronic
1170994671 20:21341180-21341202 TTCTCCCTTCTCCAAAGAATAGG + Intronic
1172123578 20:32612455-32612477 TTCCCTCCCTTCCAAAGACTAGG + Intergenic
1172868154 20:38115653-38115675 TTCAGCCTCATACAATGAATTGG + Intronic
1172999106 20:39092713-39092735 TTCTCCTTCTTCCAAGGCATAGG - Intergenic
1173254199 20:41381896-41381918 TTCACCCACGTCCAAAGGTTTGG - Intergenic
1174171930 20:48623119-48623141 TTCAGCATTTTCCAAAGGATTGG + Intergenic
1179314257 21:40227389-40227411 ATGACCCTTTTCCAAAGAGTTGG - Intronic
1179590746 21:42406249-42406271 CTGACCCTTTTCCCAAGAATGGG + Intronic
1183352692 22:37342891-37342913 TTCTCCATCTTCCAATGAATGGG - Intergenic
1184971372 22:48023457-48023479 TTCAACCTCTTCCAGATTATAGG + Intergenic
949204391 3:1420636-1420658 TTCTCCCTCCTCCAATGGATGGG + Intergenic
949792749 3:7811315-7811337 TTAACCTTCTTCCCAGGAATTGG - Intergenic
953408251 3:42671090-42671112 TACACCCTCTTCCATACAACAGG + Intergenic
954317960 3:49811534-49811556 TCCACCCTGTTCCACAGAAGAGG + Intronic
955034467 3:55252729-55252751 CCAACCCTCTCCCAAAGAATAGG - Intergenic
958068423 3:88576449-88576471 TTTACTTTCTTCTAAAGAATAGG + Intergenic
958687654 3:97420648-97420670 TTCAAGCTTTTCCTAAGAATGGG + Intronic
962485270 3:135836296-135836318 CTCCACCTCTTCCAAAGTATAGG - Intergenic
962776037 3:138661028-138661050 TTGACCCTCATCAAAAGACTAGG - Intronic
964858235 3:161170747-161170769 TTCACCATCTTCTAGAGAACTGG - Intronic
966607865 3:181839449-181839471 TTCAGGCTGTTCCAAGGAATAGG - Intergenic
968809151 4:2792394-2792416 ATCACCCTCTCCCTAAGAGTAGG - Intergenic
969129474 4:4981072-4981094 TTCTCCCTCTTCCAGAAAACTGG + Intergenic
970283038 4:14478999-14479021 TTCCCCCTTTTCCTAGGAATGGG - Intergenic
970751237 4:19364473-19364495 TTCACCATATTCCAAATAGTAGG - Intergenic
977751207 4:100611861-100611883 TTCACACTCTTCCTAGAAATTGG - Intronic
978463745 4:108985343-108985365 TTCACCCTCTCCTAAAGACAAGG + Intronic
983995712 4:174179167-174179189 GTCACCCTCTTTCAAAGAAGAGG - Intergenic
985079944 4:186254497-186254519 ATCACTCTCTTTCAAAGAACTGG - Intronic
986041759 5:4000550-4000572 TTGAATCTCTTCCAAAAAATAGG + Intergenic
986292735 5:6412932-6412954 TTCCTCCTCCTCCAAAGAGTAGG + Intergenic
987361419 5:17110424-17110446 ATAGCTCTCTTCCAAAGAATGGG - Intronic
987512550 5:18858171-18858193 TTGACCCTGTTCCAAATAAGGGG + Intergenic
987750662 5:22034607-22034629 CTCACTCTTTTACAAAGAATAGG + Intronic
988638266 5:33011479-33011501 GTCATCCTCTTCCATAGAAAGGG + Intergenic
990802552 5:59621222-59621244 ACCACCCTCTTCCAGAGACTGGG + Intronic
991502683 5:67292677-67292699 TTCACCCTGTGCCTTAGAATTGG - Intergenic
992215529 5:74521297-74521319 TTCAGTCTCTTCTAAAGAGTTGG + Intergenic
995056436 5:107764602-107764624 TTCACCTTCTTCCCAAGGAAGGG + Intergenic
997018266 5:129963739-129963761 TTCATTTTCTTCCACAGAATTGG + Intronic
1000716585 5:164651965-164651987 TTCACCATCCTCGAAAAAATTGG + Intergenic
1004137220 6:12979052-12979074 TTCAGCTTCTTCTAAAGAAAGGG - Intronic
1010304106 6:74297710-74297732 TTCAAACTCTTCCAAAAAAGTGG + Intergenic
1012795924 6:103761292-103761314 TTCAAACTCTTCCAAAAGATTGG + Intergenic
1015255385 6:131173521-131173543 TTCACCCTATCCCTAAAAATAGG - Intronic
1016814974 6:148294898-148294920 ATCTGCCTTTTCCAAAGAATGGG + Intronic
1017348801 6:153415512-153415534 TTCACTTTCTTCCACAGACTTGG - Intergenic
1022461755 7:30615330-30615352 TTCATCCCATTTCAAAGAATGGG - Intronic
1024464454 7:49696931-49696953 TTCACCCCCTTCCAGACAAATGG - Intergenic
1025616214 7:63119690-63119712 CCCAAACTCTTCCAAAGAATTGG + Intergenic
1027508740 7:79052478-79052500 TTCCCACTCTTCCCAAGAAATGG + Intronic
1027520669 7:79202702-79202724 ATCACTTTCTTCCACAGAATTGG + Intronic
1028733302 7:94178251-94178273 TTCTCCCTTTTCCACAGGATGGG + Intergenic
1028823372 7:95239527-95239549 CTCACTCTCTTGCAAAGATTGGG - Intronic
1030025098 7:105315887-105315909 CTAACCCTCTTTCAAAGTATAGG + Intronic
1030615000 7:111729598-111729620 TTCCCTCTCTTCCAAACTATAGG - Intronic
1030685536 7:112483365-112483387 CTCACCATTTTCAAAAGAATTGG - Intronic
1040289971 8:46119268-46119290 ATCACCCTGTTCCAAAGCCTGGG + Intergenic
1040304859 8:46206722-46206744 GGCACCCTCTTCCAAAGCCTGGG - Intergenic
1040324236 8:46333611-46333633 GTCACCCTGTTCCAAAGTCTGGG - Intergenic
1040329408 8:46378286-46378308 TGCACCCTGTTCCAAAGCCTGGG - Intergenic
1040333937 8:46406584-46406606 TGCACCCTGTTCCAAAGCCTCGG - Intergenic
1042901174 8:73729455-73729477 CTCAAACTCTTCCAAAAAATTGG - Intronic
1043014298 8:74919472-74919494 TTCACACCCTTCCAAACAAGTGG - Intergenic
1045742510 8:105377934-105377956 TACACACTCATCCAAAGAAAGGG - Intronic
1049559159 8:143299339-143299361 TACACCCTCTTCCCAACAACCGG - Intergenic
1049630123 8:143649408-143649430 ATCACCCTCCTGCACAGAATCGG - Intronic
1049886858 9:33278-33300 TTCACCTTTTTCCAAAGTGTTGG - Intergenic
1057642720 9:96841340-96841362 TACAACCTCTTCCAGAAAATTGG + Intronic
1059802929 9:117769120-117769142 GTCACCACCTTCCAGAGAATAGG - Intergenic
1059844518 9:118259660-118259682 TTTACTCTCTTCCACAAAATTGG + Intergenic
1060353158 9:122877473-122877495 TTCAAGCTCTTCCTGAGAATGGG + Exonic
1061274699 9:129562978-129563000 TTCCACCTCTTCCAAAGCACAGG + Intergenic
1188310596 X:28612284-28612306 TTGACCTTCTTTCAAAGAAAGGG + Intronic
1192272938 X:69600686-69600708 TTCTCCCACTTCCAAAGTGTAGG - Intergenic
1194346364 X:92771522-92771544 TTCACCCTCTACCAAGGGCTGGG + Intergenic
1195387986 X:104331367-104331389 TTAACACTCTTCAAAAGTATTGG + Intergenic
1196243864 X:113375101-113375123 CTCACCTTCTGCAAAAGAATTGG - Intergenic
1198133705 X:133725718-133725740 TTCCAGCTCTTCCAAGGAATCGG + Intronic
1199427633 X:147721575-147721597 TAAACCCTCTTCCAATGTATAGG + Intergenic
1200654700 Y:5888171-5888193 TTCACCCTCTACCAAGGGCTGGG + Intergenic