ID: 927579887

View in Genome Browser
Species Human (GRCh38)
Location 2:24233128-24233150
Sequence GTTCTGTCCTTGGGCAATAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927579883_927579887 19 Left 927579883 2:24233086-24233108 CCATGCACTGTAGCACTTTGTAT 0: 1
1: 0
2: 0
3: 12
4: 138
Right 927579887 2:24233128-24233150 GTTCTGTCCTTGGGCAATACGGG 0: 1
1: 0
2: 0
3: 11
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927579887 Original CRISPR GTTCTGTCCTTGGGCAATAC GGG Intronic
900092817 1:927809-927831 GTTCTGTCCTTGGGCAGGGTGGG + Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901085826 1:6611816-6611838 AATATGACCTTGGGCAATACAGG + Intronic
908954550 1:69606737-69606759 ATTCTTTCCTTGAGCAATATGGG + Intronic
912175923 1:107156713-107156735 GTTCTGTCCCTGGACCACACAGG - Intronic
913211155 1:116583589-116583611 TTTGTGGCCTTGGGCACTACTGG - Intronic
919487080 1:198158230-198158252 TTACTGTCCTTGCGCAATTCTGG + Intronic
920587515 1:207181390-207181412 GTAGTGTCCATGGGCAATACTGG - Intergenic
1066228656 10:33410623-33410645 GATGTGTCCTTGAGCAAGACAGG + Intergenic
1068121524 10:52786043-52786065 GTTCTGTGCTAGGGCTGTACTGG - Intergenic
1070761148 10:79025136-79025158 GAGCTGTCCTTGGGCATCACTGG - Intergenic
1078742428 11:14079738-14079760 GATCAGTACTTGGGCAATAAAGG - Intronic
1081313804 11:41605841-41605863 GATCTTTACTTGGGCTATACAGG - Intergenic
1085466776 11:76729490-76729512 GTTCTGTATTTGTGCAACACAGG - Intergenic
1090763958 11:129860974-129860996 GTTCTTTCCTTGGGGACTGCAGG + Intergenic
1104716761 12:131020709-131020731 GCTCTGTCCTTGTGCAGTGCGGG + Intronic
1109548002 13:63853896-63853918 GTTTTGAACTTGGGTAATACAGG - Intergenic
1117772544 14:59149567-59149589 GCTCTGACCTTGGGCATAACTGG + Intergenic
1125274893 15:37979352-37979374 GTTCTGTCCGAGGGCAGTGCAGG + Intergenic
1125727280 15:41874537-41874559 GTTCTTTCCTTGGCCAAGCCAGG + Intronic
1126104977 15:45141533-45141555 GTTCTGCCCTTGGGAACTCCAGG + Intronic
1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG + Intronic
1130337720 15:82971739-82971761 GTTCTGTCCTTGCACAGTAAAGG - Intronic
1132789103 16:1675219-1675241 GCTCTGTCCTGGGGAAAGACTGG - Exonic
1138099442 16:54240680-54240702 CTTCTTTCCTTGGGGAATAATGG - Intergenic
1141027809 16:80564329-80564351 GCTCTGTCCTTGGGCAAAAGTGG + Intergenic
1141960872 16:87407195-87407217 GTGCTGACTTTGGGCAATAAAGG + Exonic
1146412463 17:32598529-32598551 GGTCTGTGCTTGAGCCATACTGG + Intronic
1150270715 17:63862708-63862730 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150274344 17:63886229-63886251 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150276487 17:63901057-63901079 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1159115402 18:64107635-64107657 TTTCTGTACTTGGGCAAGCCTGG - Intergenic
1167229211 19:48271265-48271287 CTTCTTTCCTTGGGAAATGCAGG + Exonic
1168400951 19:56086082-56086104 GCTCTGGCCTTGGGCACTTCTGG - Intergenic
925801800 2:7609307-7609329 GTCCTGTCCCTGAGAAATACAGG - Intergenic
926757902 2:16250700-16250722 GTTCTGCCCTTGGGGACTCCTGG - Intergenic
926780498 2:16466804-16466826 GTTCTTTCCTGGGGCAGTATAGG + Intergenic
927579887 2:24233128-24233150 GTTCTGTCCTTGGGCAATACGGG + Intronic
931219819 2:60278764-60278786 GTTCTGGCCTTGGGCAGCAGGGG + Intergenic
935548410 2:104425138-104425160 GTGGTGTCCTTGGCCAATGCAGG + Intergenic
936055745 2:109260724-109260746 ATACTGTCCATGGGCAATCCAGG + Intronic
937093509 2:119222191-119222213 GTGCTGTCCTTGGGCATTAAAGG + Intergenic
937435749 2:121879758-121879780 GTTCCCTCCTTGGGTAAGACAGG + Intergenic
938953417 2:136278033-136278055 CTTCTGTTCCTGGGCAATAAGGG + Intergenic
941958499 2:171229533-171229555 GTTCTGTCCTCTGGCAGAACAGG - Intronic
943530614 2:189075982-189076004 GCTCTTTCCTTGGTCAATGCAGG + Intronic
944731039 2:202517772-202517794 GTTCTGGCCTTGGGAAACTCAGG - Intronic
1169341186 20:4797674-4797696 GTTCTCTCGTTGGGCAATTCGGG - Intronic
1173095348 20:40022649-40022671 GTTCTGTCTTTGGGAAATGATGG - Intergenic
1177493681 21:21861682-21861704 GTTCATTCCTTAGGCAACACTGG + Intergenic
1179353599 21:40636981-40637003 GTCCTGTCTTTGGTCTATACAGG - Intronic
1179834516 21:44021174-44021196 GTTCTGTCCTTTGGGGATCCTGG + Intronic
1180043154 21:45290850-45290872 TTTCTGTCCATCGGCCATACGGG - Intergenic
1181985681 22:26798625-26798647 GCTCTGTGCTTGGGGAATCCCGG - Intergenic
1182576016 22:31273437-31273459 GCTCTTTCCTTGGGGAACACAGG - Exonic
1182793851 22:32976192-32976214 GTACTGTCCTTGTGTAATATTGG - Intronic
1183998548 22:41654831-41654853 GGTCTTTGCTGGGGCAATACAGG + Intronic
951622389 3:24617187-24617209 GTTATGTCCTTGGACAAGGCGGG + Intergenic
959968708 3:112384417-112384439 GTTTTGTCATTTGGCAAGACTGG - Intergenic
967251477 3:187544619-187544641 GTTCTGTCCTAGGGATATACAGG - Intergenic
972798024 4:42442002-42442024 GTTTTGTGTTTGGGTAATACTGG + Intronic
979585361 4:122409014-122409036 GTGCTGTCCTTGGACAATTATGG - Intronic
981576763 4:146213685-146213707 GTTCTGTGTGTGGGGAATACTGG + Intergenic
981830277 4:148991771-148991793 GTCATGTTCTGGGGCAATACAGG + Intergenic
982851440 4:160321182-160321204 TTTCTTTCCTTTGGAAATACTGG + Intergenic
984617340 4:181913629-181913651 GTTCTGTCCTTAGGCATCCCTGG - Intergenic
990326079 5:54676634-54676656 GTGCTGTACTTGGGCAACTCAGG - Intergenic
990879258 5:60521169-60521191 GCTTTGTACTTGGGCAATATGGG - Intronic
997735536 5:136209977-136209999 GTTCTGTCTTTGGGCCTTGCTGG + Intergenic
997983999 5:138489425-138489447 GTTTTGACCTTGAGCAAAACAGG - Intergenic
1002057644 5:176607841-176607863 GTTTTGTGCTTGGGCACAACTGG - Intronic
1010318896 6:74484063-74484085 GTTTTGGCATTGGGTAATACTGG + Intergenic
1010813954 6:80332984-80333006 GGTCGGTCATTGGGGAATACAGG - Intronic
1011253937 6:85402363-85402385 GTTTTGTCCTGGGGCAAGATGGG - Intergenic
1013769392 6:113610534-113610556 ATTCTGTCCTTGGGCCATAAAGG - Intergenic
1014275127 6:119379444-119379466 GTTCTGCCTTGGGGCAATAGAGG - Intergenic
1016756511 6:147693446-147693468 GTCCTGCCCTGGGGCAATAAGGG + Intronic
1019330844 7:460095-460117 CTTCTCTCCTTGGGCCATCCTGG - Intergenic
1023640376 7:42251120-42251142 GTACTGTCCTGGGGCAACACTGG + Intergenic
1026929454 7:74215799-74215821 GTTCTGTCCTTGCCCAGTGCAGG + Intronic
1031316885 7:120269635-120269657 GTGCTGTACTTGTGCAAGACTGG - Intergenic
1032450181 7:132023906-132023928 GTTCTGACCATCGGCAATGCAGG - Intergenic
1033824317 7:145170897-145170919 GTTCTGTCATTGGGCTAAACTGG + Intergenic
1034290013 7:149922869-149922891 GCTCTGTCCTCTGTCAATACAGG + Intergenic
1041719173 8:60960894-60960916 ATTCTGACCTTGAGAAATACAGG + Intergenic
1043176542 8:77028778-77028800 GTTTTGTCCTTGGGCCAAAGTGG - Intergenic
1050187445 9:2989529-2989551 TTTCTGTTGTTGGGCAATACAGG - Intergenic
1060908769 9:127331982-127332004 GTTCTGTTCTGTGGCAAAACAGG - Intronic
1061735967 9:132659320-132659342 GTTCTGTCCTCGAGCACAACTGG + Intronic
1062128261 9:134878229-134878251 GTTCTGTCCCTGATTAATACAGG + Intergenic
1187425557 X:19174706-19174728 GCTCTGTCCATGGGCATGACAGG - Intergenic
1190077457 X:47328288-47328310 GTTCTCTCCTTGCGCATTGCAGG - Intergenic
1195303617 X:103556939-103556961 TTTCTATCATTGGGTAATACAGG - Intergenic
1198986753 X:142463498-142463520 GATCTTTTCTTGGGGAATACTGG + Intergenic
1199854758 X:151751347-151751369 GTTCTGTACATGCCCAATACTGG + Intergenic
1201400293 Y:13597523-13597545 GTTCTTTCCTCAGGCAATGCAGG + Intergenic