ID: 927582242

View in Genome Browser
Species Human (GRCh38)
Location 2:24262529-24262551
Sequence AGGGAGAAACACTGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 445}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927582242_927582247 11 Left 927582242 2:24262529-24262551 CCATCCTCACAGTGTTTCTCCCT 0: 1
1: 0
2: 4
3: 32
4: 445
Right 927582247 2:24262563-24262585 TCCTTGTTCCTTAAACACTAAGG 0: 1
1: 0
2: 3
3: 20
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927582242 Original CRISPR AGGGAGAAACACTGTGAGGA TGG (reversed) Intronic
900140784 1:1138816-1138838 AGGGAGAAGCTCTCTGAAGACGG + Intergenic
902060557 1:13638565-13638587 AGGCTGAAACACAGTGGGGATGG + Intergenic
902243017 1:15101225-15101247 AGAGAGAGACACTGAGAGAAAGG - Intronic
902833122 1:19030250-19030272 AGGGAGAAAAAGTGGGAGGCTGG + Intergenic
903167411 1:21530614-21530636 AGGGAGAAACAGTGAGGAGAAGG + Intronic
903821134 1:26103429-26103451 AGGGAGAAACTCCTTTAGGAAGG - Intergenic
904948113 1:34214179-34214201 AGTGAGCAGCACTGGGAGGAGGG + Intronic
905118079 1:35659872-35659894 GGGGAGAAAAACTCTGTGGAGGG - Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906299863 1:44674133-44674155 AGGGAGGAACACTCTGGGGCGGG + Intronic
908156017 1:61354061-61354083 AGGGGGAAACACTGTTTGGGAGG - Intronic
908680135 1:66651616-66651638 GGGGAGAAAGTCTGTGAGGTGGG - Intronic
908790277 1:67774315-67774337 AGGGAGGAAATCTGTGGGGAAGG - Intronic
909477358 1:76095785-76095807 AGGGAGGACAACTGAGAGGATGG - Intronic
910527472 1:88197472-88197494 TCAGAGCAACACTGTGAGGAAGG + Intergenic
910663556 1:89700156-89700178 AGGGAGAAAGACTGAAAAGATGG - Intronic
910820037 1:91336320-91336342 AGGGAGAAAGTATGAGAGGAAGG - Intronic
911842265 1:102698129-102698151 AGGGAGAAACAGTGTTGGAAAGG - Intergenic
912219095 1:107651523-107651545 AGGAAGAAACAAAGTAAGGAAGG + Intronic
914704881 1:150162446-150162468 GAGGAGAAGCACTGGGAGGAAGG - Intronic
914716752 1:150260230-150260252 AGGAAGACACACTGTGCGGGTGG + Intronic
915041973 1:152976105-152976127 AAGGAGGAATACTGGGAGGATGG - Intergenic
916138737 1:161675418-161675440 AGGGAGCAGCAGTGGGAGGATGG + Intronic
916152324 1:161806953-161806975 AGAGAGGAACACTGTGTGCAGGG - Intronic
916254395 1:162771944-162771966 AGGAAGGAACTCTGAGAGGAGGG - Intronic
916874157 1:168950936-168950958 AGGAAGAAATATTATGAGGATGG + Intergenic
917249211 1:173038926-173038948 AGGCAAAAACAGTGTGAGAAGGG + Intergenic
917618207 1:176767957-176767979 ATGGAGAAACACTGGGAAGCGGG + Intronic
918207024 1:182318504-182318526 AGGGAGAATCTCAGTGAAGATGG + Intergenic
918703549 1:187635198-187635220 AGGAAGAAACGCTGTGAGTCTGG + Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
919911729 1:202115277-202115299 AGGGAGAAACACTGTGCCCCTGG - Intergenic
920365847 1:205448074-205448096 AGGGAGATTCCCTCTGAGGAAGG - Intronic
920419210 1:205819105-205819127 AGGAGGAAACACTGTGACAAAGG + Intergenic
921338202 1:214108839-214108861 AGAGAGAAGCTCTGTGAGAAGGG + Intergenic
921621628 1:217331914-217331936 AGGATGAAATACTTTGAGGACGG - Intergenic
921710754 1:218370883-218370905 AGGGAGAGAGGCTGTGGGGATGG + Intronic
921804807 1:219442165-219442187 GGGGAGAAAAACAGGGAGGAAGG - Intergenic
922468395 1:225860660-225860682 AGGGAGGAACACTGGAGGGAAGG + Intronic
923009191 1:230074665-230074687 GGGGTGAACCACTGTGGGGAGGG + Intronic
923734864 1:236596475-236596497 AAGGAGAAACGCTGAGAGGCAGG + Intronic
1064873548 10:19966866-19966888 AGGGGGAAACACTGGGGAGAGGG + Intronic
1064974525 10:21099718-21099740 AGGGAGAAAGACTGTGAGCCAGG + Intronic
1067222157 10:44352221-44352243 AGGGAGACAAAGAGTGAGGAGGG - Intergenic
1067467079 10:46509114-46509136 AGCCAGAAACACTGGGAGAAGGG + Intergenic
1067620107 10:47875491-47875513 AGCCAGAAACACTGGGAGAAGGG - Intergenic
1068229687 10:54156233-54156255 ATGTTGAAACACTGAGAGGAAGG - Intronic
1069105119 10:64374214-64374236 AGGGAGAGAGAATGGGAGGAAGG - Intergenic
1070167031 10:73906694-73906716 AGGCAGAAAAAGAGTGAGGAAGG + Intergenic
1070172210 10:73941317-73941339 AGGGATAAAGACCATGAGGACGG - Intergenic
1070744788 10:78927241-78927263 AGGGAGACACACTGAGAGACTGG + Intergenic
1071455960 10:85851881-85851903 AGGGAGAAAAAAATTGAGGATGG - Intronic
1072287130 10:93926993-93927015 AGGGAGAAGGACTGGCAGGAAGG - Intronic
1074523189 10:114243210-114243232 AGGGAGAAAAGCTGGGAAGATGG - Intronic
1074697840 10:116066698-116066720 GGGGAGAACCACTGTGATGCAGG - Intronic
1074937975 10:118204976-118204998 GGGCAGAACCACTGTGAGAAAGG - Intergenic
1075797093 10:125128400-125128422 AGGGAGAGACATTGGGAGGCGGG + Intronic
1076070692 10:127486120-127486142 AGGAAGGAACAGTGTGAGAAGGG - Intergenic
1076444385 10:130502048-130502070 AGGGTGGAACACTGGGAGGTAGG - Intergenic
1076577517 10:131479556-131479578 AGGAACCAGCACTGTGAGGAAGG + Intergenic
1078108145 11:8371551-8371573 AGGGAGAAAGCATGGGAGGAAGG + Intergenic
1078368258 11:10724103-10724125 GGGGAGGACCACTGTGGGGAGGG + Intergenic
1078426287 11:11253768-11253790 TGGGAGAAACACTGGGGGAAGGG - Intergenic
1078675834 11:13412889-13412911 TGGGAGAAACAATGGGAGTAGGG + Intronic
1080431945 11:32207533-32207555 GAGGAGGAACTCTGTGAGGACGG + Intergenic
1081498470 11:43640183-43640205 TAGGAAAAACACTGTGGGGAGGG + Intronic
1081673186 11:44953128-44953150 AGGGTGAGGCACTGTCAGGATGG - Intergenic
1083311130 11:61784323-61784345 AAGGAGGAACCATGTGAGGAGGG + Exonic
1084095168 11:66906614-66906636 AGGGGGAAAGACTGGGGGGATGG - Intronic
1084377961 11:68791337-68791359 AGGGAGACACTGTGAGAGGATGG + Intronic
1085325593 11:75604111-75604133 AGGGTTTAAAACTGTGAGGAAGG - Intronic
1085716360 11:78877189-78877211 AGGAAGAAGCACTGAGTGGAAGG + Intronic
1085728383 11:78975142-78975164 AGGGAGAAAAGCTGTGAGGGAGG + Intronic
1086774414 11:90812359-90812381 ACAGAGAAAGACTGTGAGGATGG + Intergenic
1087294678 11:96357126-96357148 AGGGACAGACAGAGTGAGGATGG + Intronic
1087858501 11:103123778-103123800 AATGAGAAACGCTGTGTGGAAGG - Intronic
1087940812 11:104094515-104094537 AGGAAGACAAACTTTGAGGATGG - Intronic
1088073947 11:105823990-105824012 AAGGAGAGACCATGTGAGGATGG + Intronic
1089004126 11:115076650-115076672 AGGGTGAGACAGTTTGAGGAAGG - Intergenic
1089299100 11:117487774-117487796 AGGGAGAGACACTGCAAGGGGGG + Intronic
1089447366 11:118564224-118564246 AAGGAGAATAACAGTGAGGAAGG - Intronic
1089499448 11:118923838-118923860 AGGGAGAGAGACTGGGAGGCTGG - Intronic
1089711643 11:120319130-120319152 AAAGAGAAACACAGGGAGGAAGG - Exonic
1089920654 11:122206620-122206642 AGGGAGAAACATTTAGAGGTAGG + Intergenic
1091332736 11:134743445-134743467 GAGGAGAAACACAGTCAGGAGGG - Intergenic
1091765137 12:3115075-3115097 AGGGAGAAAAACTGGGGGCAGGG - Intronic
1091951448 12:4596355-4596377 AGGGAGAGGCACAGTCAGGAAGG - Intronic
1093267447 12:17020312-17020334 AGGGAGAGACACAGGGAGGAAGG - Intergenic
1093661650 12:21764159-21764181 TGGAAGAAAGACTGGGAGGAGGG + Intergenic
1094155797 12:27335713-27335735 AGAGAGAAAGAGTGAGAGGAGGG + Intronic
1094222929 12:28013715-28013737 AGGGAGATCCACTGGGAGAATGG - Intergenic
1096797060 12:54084538-54084560 AGGGAGGAACACAGTCAGAAAGG - Intergenic
1098118637 12:67209903-67209925 AGAAAGGAACACTGTGAGAAGGG - Intergenic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1098482651 12:70983931-70983953 AGCGAGAATCCCTGTGGGGAGGG + Intergenic
1098491916 12:71092368-71092390 ACAGAGAAACACTGTGTGCATGG - Intronic
1098592765 12:72232832-72232854 AGGCAGAAAAACTGTAGGGAGGG - Intronic
1099213881 12:79830003-79830025 AGGGAGAGAAAATGTGAAGAAGG + Intronic
1099408662 12:82295419-82295441 AGGGAAAAACCCTGAGAGGCTGG - Intronic
1100316596 12:93450347-93450369 AGAGAGAAAAAATGGGAGGAGGG + Intergenic
1100664282 12:96733992-96734014 AGGGAGGAAGAGTGTGGGGAGGG + Intronic
1101589700 12:106114699-106114721 AGGGATAAACACTCTGAGCAAGG + Intronic
1101688480 12:107050183-107050205 AGAGAGAAAAACAATGAGGAGGG + Intronic
1102490449 12:113287121-113287143 AGGGAGAAAGAGAGGGAGGACGG + Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1103241162 12:119414342-119414364 AGGGAGACACACAGTGAGGATGG - Intronic
1104406439 12:128521193-128521215 AGAGATAATCACTTTGAGGATGG - Intronic
1104576032 12:129966566-129966588 TGGTAGAAACACTGTCACGATGG + Intergenic
1105215740 13:18283817-18283839 AGTCAGAAAAACTGTGAGTAAGG + Intergenic
1106069871 13:26399435-26399457 AATCAGAAACTCTGTGAGGAGGG + Intronic
1107633791 13:42371397-42371419 AGGGAGAAGGATTGGGAGGAGGG - Intergenic
1108006914 13:45957743-45957765 AAGGAAAAACTATGTGAGGAAGG - Intronic
1108571190 13:51753120-51753142 AGGGAGGAACATTGTGCTGAAGG + Intronic
1109559469 13:64027962-64027984 TGGGACAAGAACTGTGAGGAGGG + Intergenic
1109837987 13:67883756-67883778 AGGGAGCAACAGAGAGAGGAGGG - Intergenic
1111225022 13:85258721-85258743 AGAGAGAAACACTGTGATTCTGG - Intergenic
1111573740 13:90121911-90121933 AGGAAGAAACACAGTAAGAAGGG - Intergenic
1111736476 13:92146657-92146679 TGGGGGAAACAGTGGGAGGAGGG - Intronic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1112929430 13:104715559-104715581 AGGGAGAAAGACAGAGAGAAGGG + Intergenic
1113247918 13:108419713-108419735 AGGGAGAAACACCATAAGGTAGG + Intergenic
1113710685 13:112462529-112462551 AGGGACAAACAGAGTGAGGGAGG + Intergenic
1114020515 14:18474176-18474198 AGGGACAAACACTGAGAACACGG + Intergenic
1114026958 14:18536601-18536623 AGGGACAAACACTGAGAACACGG - Intergenic
1114239196 14:20850420-20850442 AAGGAAGAACCCTGTGAGGATGG + Intergenic
1115654493 14:35430491-35430513 TGGCAGAAAAACTTTGAGGAAGG + Intergenic
1116755579 14:48943963-48943985 AGGGAGAAAAACATGGAGGATGG - Intergenic
1117331505 14:54717101-54717123 AGGGAGCTACATTGTGAGAAAGG + Intronic
1117795841 14:59393712-59393734 AGAGAGATGCACTGTGAGAAGGG - Intergenic
1120590318 14:86366318-86366340 AGGGAGAAAGAAAGGGAGGAAGG + Intergenic
1120997976 14:90431097-90431119 AATGTGAAACAGTGTGAGGAAGG - Intergenic
1121470083 14:94146058-94146080 AGGGAGCAACTGTGTGAGGTAGG + Intergenic
1121718144 14:96090692-96090714 AGGGAGAAAGGATGGGAGGAGGG + Exonic
1121739531 14:96241670-96241692 AGGGAGCATGGCTGTGAGGATGG + Exonic
1121960915 14:98258623-98258645 AGGGAGAAACACAGTCAGAGAGG - Intergenic
1121986393 14:98510544-98510566 AGGAAGAAAAACTCTGAGAAAGG + Intergenic
1123683902 15:22783944-22783966 AGTGAGAAACACTAAGAGGGTGG - Intronic
1126555271 15:49980635-49980657 AGGGAGGAGAACTGTGAGGTGGG + Intronic
1126785709 15:52176498-52176520 AGGGACAAACACACTTAGGAAGG + Intronic
1126813007 15:52427433-52427455 GGGAAGAAACACAGTAAGGAGGG + Intronic
1127632473 15:60840044-60840066 AGGGATAAAAGCTGTGATGATGG + Intronic
1129114083 15:73355292-73355314 AGGAAGAGACAGTGAGAGGAAGG - Intronic
1129524405 15:76204672-76204694 AGGGAACAGCACTGTGAGCAGGG + Exonic
1129635458 15:77311969-77311991 AGGGATGAACACTGGGAGTAGGG + Intronic
1129695804 15:77740098-77740120 TGGGAGACACACTGGGATGAGGG + Intronic
1130679239 15:85981770-85981792 AGAGAGAACCACTTTGAAGACGG + Intergenic
1131529526 15:93179850-93179872 AGGGAGAAAGGATGGGAGGAAGG + Intergenic
1131577246 15:93604314-93604336 AGGGAGAGCCACCGTAAGGAAGG + Intergenic
1132067523 15:98744442-98744464 AGGGAGGAATACTGTGGGGAGGG + Intronic
1133116774 16:3582069-3582091 AGGGAGACACACTGTGAGCACGG + Exonic
1133140779 16:3742267-3742289 AGGAGGCAGCACTGTGAGGAAGG - Intronic
1133677394 16:8087765-8087787 AGGGAGAGAGACTGAAAGGATGG - Intergenic
1133944030 16:10333737-10333759 AAGGAGACACCCTGGGAGGAAGG + Intronic
1134287989 16:12879160-12879182 AGGGAGGAAGACAGGGAGGAAGG - Intergenic
1135552620 16:23409704-23409726 AGGGAAAAACTGTCTGAGGAAGG + Intronic
1136508725 16:30722933-30722955 AGGAAGCTACACTGAGAGGAAGG - Intronic
1137483308 16:48870361-48870383 AGGAAGCAACACTGTGTGTAGGG + Intergenic
1137534252 16:49305705-49305727 GGGGAGAAACAGGGAGAGGAAGG - Intergenic
1138242594 16:55439822-55439844 AGGCAGAAAGACAGTGAGGCAGG + Intronic
1140170394 16:72598666-72598688 AGGGACAGACACTGAGTGGAAGG + Intergenic
1140291421 16:73662362-73662384 AGGGAGAAACGCTGTGACCGTGG - Intergenic
1140703559 16:77605042-77605064 AGGGAGAAAAACTATGATGCAGG - Intergenic
1141303806 16:82842041-82842063 AGGGAGAAATACAGGGAGGGAGG - Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141764689 16:86050817-86050839 AGGCAGAAGCACTGCCAGGAGGG - Intergenic
1142618391 17:1150095-1150117 TGGGAGAGACACCGAGAGGAAGG + Intronic
1142765331 17:2061188-2061210 AGGGAGAAAGGCTGAGAGCATGG + Exonic
1143105942 17:4530620-4530642 AGCCAGAAGTACTGTGAGGAGGG - Exonic
1143620237 17:8076334-8076356 AGGGACATGCCCTGTGAGGAAGG + Exonic
1143621414 17:8082626-8082648 AGGGTGAAACACTGAAAGGGAGG - Intronic
1143964183 17:10744910-10744932 AGGGAGAGAGACAGGGAGGAGGG + Intergenic
1144283353 17:13748842-13748864 AGGGAGAAGCGTTGAGAGGAAGG - Intergenic
1145230493 17:21170161-21170183 AGGGATAAACAGTGGGAGGCAGG - Intronic
1145839860 17:27985208-27985230 AGGAAGGATCAGTGTGAGGAGGG + Intergenic
1145859679 17:28198677-28198699 TGGGAGAATAACTGTGAAGAGGG - Intergenic
1146093078 17:29901751-29901773 AGGGAGAAAGAAAGGGAGGAAGG - Intronic
1146900844 17:36587055-36587077 ACGGTGAAACACTGTGTGCATGG - Exonic
1147228231 17:38997662-38997684 AGGGAGAAAGAGAGAGAGGAAGG - Intergenic
1147385285 17:40077496-40077518 AGGGATATACCCTGGGAGGAAGG - Exonic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1148482859 17:47971337-47971359 GGCGGGAAACACGGTGAGGAGGG - Intronic
1149485883 17:57042459-57042481 AGGGAGAAAGAAAGGGAGGAAGG - Intergenic
1149525449 17:57351985-57352007 GTGAAGAAACACTGAGAGGAAGG + Intronic
1149601801 17:57898275-57898297 AGGTAGAACCACAGTGTGGAGGG + Intronic
1150709014 17:67514109-67514131 AGGGAGAGACTGTGTGGGGAGGG + Intronic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1150927668 17:69550700-69550722 AGGGAAAAAGAGTGTGATGAAGG + Intergenic
1151607143 17:75144981-75145003 ACCAAGAAACACTGTGAGGCCGG + Intronic
1154007722 18:10546895-10546917 ATGGAGCTACACTGTGATGATGG + Intronic
1155503269 18:26507661-26507683 AGGGAGAAATACTGTTAGAAAGG - Intronic
1155813770 18:30276298-30276320 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
1156382837 18:36579447-36579469 GGGAAGAATCACTGTGAGCAGGG + Intronic
1156554598 18:38052944-38052966 AGACAGACACACTGTGAAGATGG + Intergenic
1156611772 18:38733464-38733486 AGGAAGAGACAGTGTGAGAATGG - Intergenic
1157442502 18:47721559-47721581 AGGGAGGAAGACAGGGAGGATGG + Intergenic
1157722391 18:49935396-49935418 AGGGGGAATCCCTGTGATGATGG - Intronic
1157866776 18:51194873-51194895 GTGGAGGAACAATGTGAGGAGGG - Intronic
1159850924 18:73526592-73526614 AGGGAGAATCACTGTCAAGCTGG - Intergenic
1163953653 19:20613959-20613981 AAGGAGAAAGAGTGTGAGAAGGG + Intronic
1164835481 19:31352600-31352622 AGGGAGAAATAGTGTCTGGATGG + Intergenic
1165258637 19:34595364-34595386 AGGGAGAAACAGTGAAAGGGTGG + Exonic
1165275532 19:34747879-34747901 AGAGAGAAACACTGGGAAGTGGG + Intergenic
1165387513 19:35519510-35519532 AGGGAGAAACACAGAGAGGAAGG - Intergenic
1165631518 19:37305580-37305602 AGGGAGAAACTTCGTGAGGATGG - Intergenic
1166145127 19:40828949-40828971 AGAGAGAGACAATGTGAGGATGG - Intronic
1166218340 19:41350889-41350911 AGGGAGGAAGACAGAGAGGAGGG + Intronic
1166325785 19:42050291-42050313 AGGGGCAAACAGTGTGTGGATGG + Intronic
1166891759 19:45998400-45998422 TGTGAGAAACACTGTTAGGCTGG + Intronic
1167148428 19:47695670-47695692 AGGGAGAAACACGGAGACGGTGG + Intronic
1167236915 19:48320871-48320893 CGGGAGAAACTATGGGAGGAGGG + Intronic
1167497366 19:49827500-49827522 AGGGAGAGGCCATGTGAGGACGG - Intronic
1167949569 19:53015442-53015464 AGGGACAAACCATGTGAGGGAGG - Exonic
1168659687 19:58155884-58155906 AGGGAGAAAGAGAGAGAGGAAGG + Intergenic
925243797 2:2360607-2360629 GGGGAGAGAGACAGTGAGGAAGG - Intergenic
925355519 2:3238493-3238515 AGAGAGAAGGAATGTGAGGAAGG - Intronic
925391772 2:3500164-3500186 AGGGAGAGAAACTGGGAGGCTGG + Intronic
925531577 2:4868873-4868895 AGTGAGAACTACTGTGAGGTGGG + Intergenic
925859809 2:8163412-8163434 AAAGAAAAGCACTGTGAGGAAGG - Intergenic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
926910583 2:17849125-17849147 AGGGAGAAAGACAGGGAGGCAGG + Intergenic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
928291535 2:30042000-30042022 AGGGAGAAACATGGGGAGAAGGG + Intergenic
929074544 2:38068877-38068899 AGAGAGAAACACTGAAAAGAAGG - Exonic
931181673 2:59907746-59907768 AATGAGTAAAACTGTGAGGAGGG + Intergenic
931268904 2:60684656-60684678 AGAGAGAAATATTGGGAGGATGG + Intergenic
933386314 2:81615044-81615066 TGGAAGAAAAACTGAGAGGAAGG + Intergenic
935103120 2:100015707-100015729 AGGCAGAAAGACAGTGAGCATGG + Intronic
935681569 2:105642776-105642798 AGGGAGAAAGGCTTAGAGGAGGG + Intergenic
936344562 2:111665352-111665374 ATGTGGAAACACTGTGAGGTGGG - Intergenic
938226981 2:129624829-129624851 AGGCGGGAACACTGTGAAGACGG - Intergenic
938980548 2:136522233-136522255 AAGGAGAAGCACAGTGAGAAGGG - Intergenic
940003136 2:148987103-148987125 AGAAAGAAGCACTTTGAGGATGG + Intronic
942048980 2:172121163-172121185 AGGGAGAAACACCTTGATGTTGG - Intergenic
942381859 2:175399888-175399910 ACCAAGAAACAGTGTGAGGAAGG - Intergenic
943799110 2:192035428-192035450 AGTGAGTAGCACTGTGAGTAGGG + Intronic
943971798 2:194419138-194419160 GGGGAAAAATACAGTGAGGAAGG + Intergenic
944245433 2:197525506-197525528 AGGGAGGATCACTTTGAGGTTGG + Intronic
944650122 2:201821402-201821424 AGGGAGAATGGCTGTCAGGAGGG + Intronic
945630729 2:212272486-212272508 AGAGAGAAAACCTGTGAGCATGG - Intronic
946129584 2:217595822-217595844 ATTGAGAAACACTGGGAAGATGG - Intronic
946519979 2:220453876-220453898 AGTGAGACACACTGTGGGGCTGG + Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947104190 2:226651017-226651039 AGGGAGAGAGACTGAGAGAAAGG - Intergenic
947609971 2:231518705-231518727 AGGGAGAAAGACTGGAGGGAAGG + Intergenic
947750330 2:232528768-232528790 AGGGAGGACCATTGTGGGGAGGG - Intronic
1168811016 20:704597-704619 AGGGAGACCCAAGGTGAGGATGG - Intergenic
1169484020 20:6011535-6011557 AAGGAGAAAGATTGTGAGAATGG - Intronic
1169783444 20:9333315-9333337 AGGGAGAGCCTCTCTGAGGAGGG + Intronic
1170016398 20:11786860-11786882 AGGGAGAAACAATCCTAGGATGG - Intergenic
1170859581 20:20090270-20090292 AGGGAGGACCTCTATGAGGAGGG - Intronic
1171848916 20:30294395-30294417 AGGGAGGAACACAGTCAGAAAGG - Intergenic
1173026549 20:39312663-39312685 AGGGTGTAACAAAGTGAGGAAGG - Intergenic
1173298176 20:41777918-41777940 AGTGAGAAACTCTGTGACTAAGG + Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175275755 20:57769527-57769549 AGGTAAAAGCACTGTGAGGAAGG + Intergenic
1177328885 21:19629946-19629968 AGAGAGAGACAGTGTGAGGGAGG - Intergenic
1178305066 21:31484518-31484540 AGGGAGAAACACACAAAGGAAGG + Intronic
1178462823 21:32818479-32818501 ATCTAGAGACACTGTGAGGATGG - Intergenic
1178496557 21:33090893-33090915 AGTGAGAAAGACAGAGAGGAAGG + Intergenic
1178681812 21:34678874-34678896 AGGGAGAAAAATTGGGAGGTTGG - Intronic
1179824735 21:43957578-43957600 AGGGGGAAACCCCGTGTGGAGGG - Intronic
1180445022 22:15405001-15405023 AGGGACAAACACTGAGAACACGG + Intergenic
1181051579 22:20240584-20240606 AGGGAGAAAAACAGTGACGTGGG - Intergenic
1181885262 22:26017068-26017090 AGGGAGAGGCACAGAGAGGAAGG - Intronic
1182320981 22:29478588-29478610 AGGGAGGGACACTGTGCTGAGGG - Intergenic
1183031971 22:35113326-35113348 AGGGAGGAGCTTTGTGAGGAAGG - Intergenic
1183336194 22:37248174-37248196 AGGGAGAAACAGGGAGAGGTGGG - Intergenic
1183642035 22:39098613-39098635 TGGCAGAAATACTGGGAGGATGG + Intronic
1184816691 22:46877439-46877461 AGGGAGAGACACTGGGAACATGG + Intronic
1185100657 22:48839264-48839286 AGGGGCCAACACTGTGGGGAAGG - Intronic
949487135 3:4550631-4550653 AAGAAGAAACACTGAGAGGTAGG + Intronic
949710246 3:6862885-6862907 ACGGAGAAAAAATGGGAGGAAGG + Intronic
949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG + Intergenic
949892972 3:8746775-8746797 AGAGAGAGAGAGTGTGAGGAGGG - Intronic
950323683 3:12083519-12083541 AAGGAGAAACTTTGGGAGGAAGG - Intronic
950494282 3:13324376-13324398 CGGCAGGAGCACTGTGAGGAAGG - Intronic
951824999 3:26859056-26859078 AGGAAGAATCACTAGGAGGAAGG + Intergenic
953360709 3:42293769-42293791 AGGGAGCAAGACAGAGAGGAAGG + Intergenic
953468410 3:43145861-43145883 TGGCAGAAGCACTGTGAGCAGGG - Intergenic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
955669354 3:61386452-61386474 TGAGAGAAAGACTGTGATGAAGG - Intergenic
956016083 3:64884497-64884519 TGGGAGAAAGACCTTGAGGAGGG - Intergenic
957593784 3:82233937-82233959 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
959099806 3:101997431-101997453 AGGGAGATGCACTGTAAGAAGGG + Intergenic
960648851 3:119923251-119923273 AGGGAGAAAAACTGTAAAGTAGG - Intronic
961917093 3:130387710-130387732 AGGGAGAAACTGTAAGAGGATGG + Intronic
962763059 3:138534906-138534928 AGGGAGAGACACTGCAAAGATGG - Intronic
963306890 3:143662924-143662946 TGGGAGAACCACTGTCAGGCAGG - Intronic
963473698 3:145776564-145776586 AGGGAGAGAAACAGGGAGGAAGG - Intergenic
963484012 3:145913428-145913450 ACTTAGAAACTCTGTGAGGATGG - Intergenic
964836945 3:160949531-160949553 AGGAAGAAACATTGTGGGCACGG + Intronic
966220769 3:177548990-177549012 AGGTATTAAAACTGTGAGGATGG + Intergenic
967257762 3:187610712-187610734 AGGGAGAAAAATGGTGAAGATGG - Intergenic
967516205 3:190372070-190372092 AGTGAGAAAGACTGTGAGACAGG - Intronic
969654549 4:8488892-8488914 AGGGGGAACCACTGCGACGAAGG + Intronic
969845766 4:9918868-9918890 AGGGCAGAACACTCTGAGGATGG + Intronic
969920784 4:10537588-10537610 AGGGAGAAAGACAGGGAGGGAGG - Intronic
970032605 4:11693831-11693853 TGGGAGAATCACTGTTATGAAGG + Intergenic
971497899 4:27287420-27287442 ATGGAGAAACACTCTGTGGATGG + Intergenic
971797978 4:31253443-31253465 AGAGAGAAACACAGTGGAGAAGG - Intergenic
971854362 4:32024735-32024757 AGGGAGAATAAATGTGAGGTAGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
973922652 4:55704539-55704561 AGGGAGGAACATTCTGAGCAGGG + Intergenic
974283865 4:59838338-59838360 ACTGAGAAACTCTCTGAGGAGGG - Intergenic
975613523 4:76223842-76223864 AGGGAGACTCACTCTGAGGGTGG - Intronic
975921965 4:79401915-79401937 AAAGAGAAACAAGGTGAGGAAGG - Intergenic
976694467 4:87904207-87904229 AGCCAAAAATACTGTGAGGATGG + Intergenic
977270980 4:94917175-94917197 ACAGAGAACCACTGTTAGGATGG + Intronic
977709286 4:100106452-100106474 AGGGACAAACACTGGGATGAGGG + Intergenic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG + Exonic
978696201 4:111583594-111583616 AGAGAGAAAGAGAGTGAGGAGGG + Intergenic
978783974 4:112588729-112588751 AGATAGAAACTCTGTCAGGAAGG - Intronic
979124810 4:116956019-116956041 AGGGAAAAACTCTATGAGTAGGG + Intergenic
979821441 4:125177489-125177511 AGTAAGGAACAATGTGAGGACGG + Intergenic
979890122 4:126081896-126081918 AGGGGCAAACACTCTGAGGCAGG + Intergenic
980710341 4:136557996-136558018 AAGAAAAAACATTGTGAGGAAGG + Intergenic
981062282 4:140437534-140437556 AGGGAGGAATGCTTTGAGGAGGG + Intergenic
981533059 4:145771601-145771623 TGGGAGAAAGAAGGTGAGGAGGG + Intronic
983370597 4:166852627-166852649 AGAAACAAACACTTTGAGGAAGG - Intronic
984228146 4:177060748-177060770 AGGGAGAATGATAGTGAGGAGGG - Intergenic
984246733 4:177283694-177283716 AGGCAGCAACACCCTGAGGAGGG + Intergenic
984779021 4:183506477-183506499 AGGTGGTAACACTGTAAGGAAGG - Intronic
984815641 4:183833680-183833702 AGGTAGAAAGAATGTGAGAAGGG + Intergenic
984857061 4:184204467-184204489 AGCGTGGAACACTGTGAGGACGG - Intronic
985195905 4:187429091-187429113 AGGGAGCAAGAGTGAGAGGAGGG + Intergenic
985379672 4:189379400-189379422 AGGGAGAAAGGCTGTGTGCAGGG + Intergenic
986343034 5:6808534-6808556 AGGGAGAAACACAGTTAGATTGG + Intergenic
986447990 5:7839455-7839477 TGGGAGAAAAACTCTGAAGAAGG + Intronic
988424850 5:31052018-31052040 AAGGAGAAAAAGTGTGAGGTGGG - Intergenic
989677829 5:43992959-43992981 AGGGAGAAACACTATGAGTTGGG + Intergenic
992389709 5:76319060-76319082 AGGGAGAATCACTTTGTGAATGG + Intronic
992645276 5:78805901-78805923 AGGGAGAGGCACTGTGAGCTTGG + Intronic
993290579 5:86063044-86063066 AGGTAGAAGAAATGTGAGGAAGG - Intergenic
993760839 5:91795203-91795225 TGGGAGGATCACTGTGATGAGGG + Intergenic
994084498 5:95743616-95743638 AGGGAGAAAGACAGGGAGGGAGG - Intronic
996374574 5:122790823-122790845 AGGCAGAAAGACTGGGAAGAAGG - Intronic
996915321 5:128705017-128705039 AGGGAGAAATACAGGAAGGAAGG - Intronic
997251720 5:132393733-132393755 TGGGAGAAACAAGGTGAGGATGG - Exonic
997677537 5:135724497-135724519 AGAGAGACGCACTGTGGGGAAGG - Intergenic
997835257 5:137186960-137186982 AGGGAGTAACACATTCAGGAGGG - Intronic
998060404 5:139114499-139114521 AGGGAGAACCACTTGGGGGATGG - Intronic
998257704 5:140601239-140601261 AGTGAGAAAAACTGTCAGGGTGG - Intergenic
999084460 5:148874709-148874731 AGGGAGAAAAGCTGTCAAGAAGG + Intergenic
999360239 5:150978663-150978685 AGGGAGAAACCCTATGAGTGTGG + Intergenic
999581622 5:153044889-153044911 AGGGAGAAACACTGAAATGGAGG + Intergenic
1000009752 5:157220156-157220178 TGTGAGAAACACTGTGAGCAGGG + Intronic
1001108368 5:168875122-168875144 AGGGAGAAAGAATGAGAGGGAGG + Intronic
1001147727 5:169199436-169199458 AGGGAGGAACACTGTGCGGAAGG + Intronic
1001257956 5:170199531-170199553 AGGGAGAGACCCTCTGAGGCAGG + Intergenic
1001509461 5:172309146-172309168 AGAGAGAGACACTGAGAGAAAGG - Intergenic
1001621819 5:173093133-173093155 AGGGTGAAACAAAGAGAGGATGG + Intronic
1001866759 5:175112994-175113016 AGGAAGAAACAGTGTTGGGAAGG + Intergenic
1002654944 5:180738675-180738697 AGGGACTAAAACTCTGAGGACGG + Intergenic
1003698651 6:8438232-8438254 AGTGAGAAACAATGAGAGAATGG - Intergenic
1004706546 6:18129218-18129240 AGCAAGAATCACTGTGAGCAAGG + Exonic
1005950478 6:30627548-30627570 AGGGAGGACCTCTGTGGGGATGG + Intronic
1006024871 6:31140252-31140274 AGGGATAAACAGTGGGAGCAAGG - Intergenic
1006089496 6:31620239-31620261 AGGGAGAAAGAGAGAGAGGACGG - Intergenic
1006150583 6:31984892-31984914 AGGGAGAAACAGTGAAAGGGAGG + Intronic
1006156884 6:32017630-32017652 AGGGAGAAACAGTGAAAGGGAGG + Intronic
1006223218 6:32513164-32513186 AGGGAGAAACAGTGAAAGGGTGG - Intergenic
1006245221 6:32728033-32728055 AGGGAGAAAGAGAGGGAGGATGG - Intergenic
1006600778 6:35224255-35224277 AGGGATAAGCATTGTGAGCAGGG + Intronic
1006820189 6:36887084-36887106 AGGTAGCAACAATGTGATGAGGG - Intronic
1006976036 6:38102425-38102447 ATGGAGAAACACTGAGTGTAGGG - Intronic
1007481071 6:42150336-42150358 AGGGAACAAAACTGTGAAGATGG + Intergenic
1007519035 6:42437365-42437387 GGGGTGAAACTCTGTGAGGGTGG - Intronic
1007524226 6:42477506-42477528 AAGGAAAAAGCCTGTGAGGAAGG + Intergenic
1007901338 6:45416077-45416099 GGGGAAAAACACTGAGAGAACGG + Intronic
1011902389 6:92314925-92314947 AGAGAGAAAGAGAGTGAGGAGGG - Intergenic
1012422285 6:99078487-99078509 AGGGAGAAAGAATGGGAGGGAGG + Intergenic
1012883059 6:104814786-104814808 AGGGAGAAAGAGCGTGAGGGGGG - Intronic
1013308403 6:108871292-108871314 AGGGAGAGACAATGTGATGTAGG + Intronic
1013360895 6:109393186-109393208 AGGGAGAAAAACAGAGGGGAGGG - Intronic
1014075264 6:117228183-117228205 ACAGAGAAACAAAGTGAGGAGGG - Intergenic
1015766958 6:136728934-136728956 AGGGAGAAACCTAGTGTGGAGGG + Intronic
1016985097 6:149889153-149889175 AGGAAGAAACAGTGGGAGGTGGG + Intronic
1019583927 7:1785883-1785905 GGAGAGAAGCACTGTCAGGAGGG - Intergenic
1021446149 7:20735768-20735790 AGGGGAAAACACAGAGAGGAAGG + Intronic
1021796784 7:24263574-24263596 TGGGAGAAACACTGTTAGATTGG - Intergenic
1021921028 7:25485049-25485071 AGGGAGAAAGAGTGGGAGAAAGG + Intergenic
1022109253 7:27218229-27218251 AGGAAGAAACAAAGGGAGGATGG - Intergenic
1022321675 7:29293743-29293765 AGGGGGAAACAGTGTGGGAAAGG - Intronic
1022346796 7:29524643-29524665 AGTCAGAAACAAGGTGAGGATGG - Intergenic
1022508850 7:30922703-30922725 AGGAAGGGACACTGTGAGGGTGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023129564 7:36988777-36988799 AGTGAGAATGACTGGGAGGATGG + Intronic
1023367326 7:39476788-39476810 TGGGAGAAACACAGTGATGCTGG - Intronic
1025231631 7:57206758-57206780 AGGGAGAAAGAAAGAGAGGAAGG - Intergenic
1025294824 7:57769111-57769133 AAGGTGAAACACAGAGAGGAAGG - Intergenic
1026187256 7:68091564-68091586 AGGGAGAACCATTGTTAGTAGGG + Intergenic
1026334132 7:69379209-69379231 AGGGAGTTACAGTGAGAGGAAGG + Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028996747 7:97109375-97109397 AGAGATAAACACTATGAGCAGGG + Intergenic
1029144114 7:98433831-98433853 AGAGCGAAACTCTGTCAGGAAGG - Intergenic
1029304743 7:99610703-99610725 AGATAGAATCACTGTGAGTATGG - Intergenic
1029412772 7:100426624-100426646 AGGGAGAAAAAGTGAGAGGGAGG - Intronic
1031204727 7:118742070-118742092 CGTGAGAAAGACTGTGAGCAGGG - Intergenic
1032205342 7:129859872-129859894 AGAGAGAGAGACTGTGGGGATGG - Intronic
1032992008 7:137404560-137404582 AGGAAGAAAGACTGTGGAGATGG - Intronic
1033798051 7:144870905-144870927 AGAAAGAAACACTGAGAGCATGG - Intergenic
1033895237 7:146061061-146061083 ATGGAGAAAGACAGTGAAGATGG + Intergenic
1034285105 7:149879154-149879176 GGGGTGAAGCGCTGTGAGGATGG - Intronic
1034858923 7:154579841-154579863 AGGCAGAGACACGGTAAGGAGGG + Intronic
1035044081 7:155952671-155952693 GGGGAGAAACACAGTGGGGAGGG + Intergenic
1035460520 7:159035777-159035799 GGGGAGAAATCCTGTGAGGTTGG - Intronic
1035971872 8:4258294-4258316 AGGGAGAAAGAGAGTGAGGGAGG + Intronic
1036017727 8:4804546-4804568 AGGGAGGAACACTGGGAGGGAGG + Intronic
1036065299 8:5373827-5373849 AGAGAGAAACATAGTGGGGAAGG - Intergenic
1037484893 8:19337907-19337929 AGACAGAAACACTGAGAAGAAGG + Intronic
1037589126 8:20298564-20298586 AGGAAGCAACAGTGTGAGGCTGG + Intronic
1037788591 8:21918095-21918117 AGGGAGAAACACGGGGAGGTTGG + Intergenic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038023076 8:23566388-23566410 AGGGAGGAACACCCTGGGGAGGG - Intronic
1039184660 8:34903734-34903756 ACAGAGAAACAATGTGAGGGTGG - Intergenic
1040533200 8:48282634-48282656 AGGGACAGAGACAGTGAGGAGGG + Intergenic
1040816493 8:51513267-51513289 CGGCATAAACACTCTGAGGATGG + Intronic
1041306722 8:56469382-56469404 AGGTAGAATCATTGTGATGATGG - Intergenic
1041598460 8:59686211-59686233 ATGGAGAAAAACTGAGAGGAAGG + Intergenic
1042808557 8:72798716-72798738 GGGGAGTAATACTGTGAGAATGG - Intronic
1043041567 8:75269500-75269522 AGGGTGAAAGCATGTGAGGAAGG + Intergenic
1043237694 8:77889384-77889406 AGGCAGAAGCACTGTGGGCAAGG - Intergenic
1043355144 8:79402947-79402969 AGAGAAAAACACTGTGATAAGGG + Intergenic
1043432478 8:80208321-80208343 AGGGAGAAACAATGTGCTGAAGG - Intronic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1045552179 8:103182582-103182604 ACAGTCAAACACTGTGAGGATGG - Intronic
1046652988 8:116859658-116859680 AGGGAGAAACATTGCGGGGGTGG - Intronic
1048174477 8:132139807-132139829 AGGTGGAAATACTGTCAGGAGGG + Intronic
1048180951 8:132193708-132193730 TGAGAGCAACACTGCGAGGAAGG + Intronic
1048428428 8:134344182-134344204 TGAGAGAAACACTGCAAGGAAGG + Intergenic
1049342454 8:142120493-142120515 AGGGAGAAGGCCTGTGAAGATGG - Intergenic
1049528906 8:143143532-143143554 AGGAAGAAACCCAGTGATGAGGG - Intergenic
1050547969 9:6725050-6725072 AGATTGAAACAATGTGAGGAAGG - Intronic
1050580096 9:7044935-7044957 AGGGAGAAAATCTTTCAGGAAGG + Intronic
1050682316 9:8126449-8126471 AAGGAGAAAGACAGTGAGAAAGG - Intergenic
1051724627 9:20076426-20076448 AGGGAGAACCCCTGTGACAATGG + Intergenic
1052190957 9:25660836-25660858 AGGCAGAGACACTGACAGGAAGG - Intergenic
1054075142 9:60521873-60521895 AGGGATAAACACTCAGAGCACGG + Intergenic
1055155248 9:73054991-73055013 TTGGTGAAGCACTGTGAGGAGGG + Intronic
1055552886 9:77447299-77447321 AGAGAGAGTCACTGTGAGGTAGG - Intronic
1055876108 9:80943438-80943460 AGGTAGAAAAACAGTAAGGATGG + Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056578459 9:87873090-87873112 AGGGAGAAAGACAGAGAGGAGGG + Intergenic
1057272272 9:93657904-93657926 AGGGTGAGACAGTGGGAGGATGG + Intronic
1057799037 9:98178596-98178618 AAGGGGAAACACTCTGAGAAAGG - Intronic
1058805081 9:108582743-108582765 TGGTAGGAACACTGTGAGGAAGG - Intergenic
1059033792 9:110731442-110731464 AGGGAGGAAGACTGGGAGGAAGG + Intronic
1060325839 9:122614868-122614890 AGAGAGAATCAGTGTGATGATGG - Exonic
1060405521 9:123371145-123371167 AAGGAAAGACACTGTGAGGTTGG - Exonic
1060963641 9:127699336-127699358 AGGCCGAAACACTGTGAGCAAGG + Intronic
1061141479 9:128770110-128770132 AGAAAGAAACAGTGGGAGGATGG - Intronic
1061670764 9:132186943-132186965 AAGGAGGAACACTGTGGGCAGGG + Intronic
1062665191 9:137666864-137666886 AGGGAGAGACCTAGTGAGGAGGG + Intronic
1203455780 Un_GL000219v1:166121-166143 AGGGATAAACACTCAGAGCATGG + Intergenic
1203456033 Un_GL000219v1:168512-168534 AGGGATAAACACTCAGAGCATGG + Intergenic
1186001954 X:5022427-5022449 AGGGGGAGACACAGAGAGGAGGG - Intergenic
1186174861 X:6915488-6915510 AAGGAGAAAGACTGAAAGGAAGG + Intergenic
1186239933 X:7555175-7555197 AGGGAGAAAGGATGGGAGGAAGG + Intergenic
1186280936 X:7992442-7992464 AGGGAGAAATAATGGCAGGAAGG - Intergenic
1186513187 X:10146571-10146593 AGGGAGAAACGCAGAGAGAACGG - Intergenic
1186786555 X:12961624-12961646 AGGCAGGAACACTGGGAGGAAGG + Intergenic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1188412635 X:29892716-29892738 AATGGGAAACAATGTGAGGATGG + Intronic
1189588670 X:42488574-42488596 AGGGAGAGAGAGTGAGAGGAAGG - Intergenic
1190439575 X:50463604-50463626 AGAGAGAAACAGAGAGAGGAAGG - Intronic
1192399505 X:70820650-70820672 CGGGAGCAAGACAGTGAGGAGGG + Intronic
1193325358 X:80173380-80173402 AGGCAGAAACTATGTGAGGCAGG + Intergenic
1193535229 X:82707062-82707084 AGGGATATTCACTGTGAGGTGGG + Intergenic
1196904916 X:120421527-120421549 AGGGAGAAACACTTTTTGGGTGG + Intergenic
1196906659 X:120443733-120443755 AAAGAGAAACATTGTGAGGCAGG + Intronic
1196943269 X:120798637-120798659 AGGGAGAAGCAATGTCAGGATGG + Intergenic
1197825549 X:130586626-130586648 AGAGAGAAATAATGTGATGAAGG + Intergenic
1198750545 X:139932964-139932986 CGAGAGAAAGACTGAGAGGAGGG - Intronic
1199592504 X:149480294-149480316 AGGGAGAAGGACTGAGAAGATGG + Intergenic
1200751353 Y:6946861-6946883 AGGCAGGAAGACTGGGAGGAGGG + Intronic
1202088479 Y:21163614-21163636 GGGGAGGAACACTGTGAGTAAGG + Intergenic