ID: 927584605

View in Genome Browser
Species Human (GRCh38)
Location 2:24290197-24290219
Sequence CTGCAAACCCTCATCTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927584601_927584605 21 Left 927584601 2:24290153-24290175 CCAAAAAAGCTGTTATCAACTTA 0: 1
1: 0
2: 2
3: 23
4: 231
Right 927584605 2:24290197-24290219 CTGCAAACCCTCATCTATATTGG 0: 1
1: 0
2: 1
3: 5
4: 83
927584603_927584605 -7 Left 927584603 2:24290181-24290203 CCAACAATACCTGTTTCTGCAAA 0: 1
1: 0
2: 0
3: 17
4: 210
Right 927584605 2:24290197-24290219 CTGCAAACCCTCATCTATATTGG 0: 1
1: 0
2: 1
3: 5
4: 83
927584602_927584605 -4 Left 927584602 2:24290178-24290200 CCACCAACAATACCTGTTTCTGC 0: 1
1: 0
2: 0
3: 22
4: 180
Right 927584605 2:24290197-24290219 CTGCAAACCCTCATCTATATTGG 0: 1
1: 0
2: 1
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927584605 Original CRISPR CTGCAAACCCTCATCTATAT TGG Intronic
900725992 1:4216652-4216674 CTGCAAACCCTCAGGTATCATGG + Intergenic
903125351 1:21244029-21244051 CTGCCAATCCTCATCTGGATTGG + Intronic
904861129 1:33538801-33538823 ATGCACACCCTCATCAATAATGG - Intronic
905715864 1:40149332-40149354 CTGCAAAGCCCTACCTATATTGG - Intergenic
913105146 1:115607467-115607489 CTCTTAACCCACATCTATATTGG + Intergenic
916882627 1:169034642-169034664 CTGCACACCCTCACCAACATTGG - Intergenic
1069084918 10:64127700-64127722 CTGCAAAGCAGCATTTATATTGG - Intergenic
1075412382 10:122238397-122238419 CTGCAAGCTCTCATTTATTTTGG - Intronic
1081415058 11:42804581-42804603 CTGCAAAACCTCATTTATTTGGG + Intergenic
1082896715 11:58199437-58199459 TTGTAAAACCTCATCTATAAAGG - Intergenic
1084504628 11:69557587-69557609 CTCCATTCCCTCCTCTATATGGG + Intergenic
1089049881 11:115536873-115536895 CCATAAACCCTCATTTATATTGG + Intergenic
1089329251 11:117678311-117678333 CTGCAAACCCTCATCTATCAAGG - Intronic
1100140581 12:91613868-91613890 ATGCAAGCCCACATCTAGATAGG - Intergenic
1107876628 13:44796479-44796501 TTGCAAACCCTGAACAATATAGG - Intergenic
1111778468 13:92692729-92692751 CTCCAAAGCCTCACCAATATCGG + Intronic
1112332345 13:98486098-98486120 CATCAAACCGTCATCTACATTGG - Intronic
1112665761 13:101571273-101571295 CTGCAAATCCTAATCTCTTTTGG - Intronic
1114339080 14:21724118-21724140 CTGGAAACCCTTATCTTTTTTGG + Intergenic
1120522066 14:85535112-85535134 ATGCAAAGCCTCTTCTAAATGGG + Intronic
1126698190 15:51342813-51342835 CTGCAGACCCTCATCCACATGGG - Intronic
1126752752 15:51893869-51893891 CTTCAAACTCTCTTCTACATTGG - Exonic
1133470089 16:6066676-6066698 GTCCAAACACTCATCTATTTCGG - Intronic
1138561038 16:57801343-57801365 CTGCACACCATCATCTATCCTGG + Intronic
1140618383 16:76695234-76695256 CATCAACCCATCATCTATATTGG - Intergenic
1140827084 16:78716605-78716627 GTGATAACCCTCATCTCTATAGG + Intronic
1151124608 17:71831337-71831359 CTGCAGACGCTCATCTGTCTAGG + Intergenic
1159810783 18:73015997-73016019 CTGGAAACCCTCATATAGAAAGG + Intergenic
1163967306 19:20758785-20758807 CTACAAACCCCCAAATATATTGG + Intronic
927300169 2:21503146-21503168 CATCAACCCGTCATCTATATTGG + Intergenic
927387915 2:22557647-22557669 CTGCAAACACTTATCTCTAATGG + Intergenic
927584605 2:24290197-24290219 CTGCAAACCCTCATCTATATTGG + Intronic
931494725 2:62790970-62790992 CCAGAAACCCACATCTATATTGG - Intronic
932995577 2:76847456-76847478 CTCCAACCCCTTTTCTATATAGG + Intronic
935644456 2:105322680-105322702 CTTCATACCCTAAGCTATATGGG - Intronic
936093131 2:109513673-109513695 CTGCAAAGCCTCATCTACGCAGG - Intergenic
938960344 2:136335144-136335166 CTGCAAACCCACATGTCAATGGG - Intergenic
942888274 2:180955806-180955828 CTCCAAAGCCTTATCTACATAGG - Intergenic
944534030 2:200692307-200692329 CTGCAAACCCAAGTCTATCTGGG + Intergenic
1172208344 20:33180543-33180565 CTGCAAACCCTCATCTGAAGAGG + Exonic
1174751333 20:53114390-53114412 CTTCAGACCCTCATCTATAAAGG + Intronic
1177978247 21:27878858-27878880 CGGCAAGCCCTCATTTATTTTGG + Intergenic
1178329283 21:31673150-31673172 GAGCAAACCCTCATGTAGATAGG - Intronic
949120095 3:374219-374241 CTGCAAACCTTTGTATATATCGG - Intronic
950285954 3:11744844-11744866 CTGCAAGACCTCATCTCTACAGG + Intergenic
955563701 3:60221935-60221957 GTGCATACCCACATTTATATAGG - Intronic
957806953 3:85160164-85160186 CTGAAAACCCTCATTTAGAAAGG - Intronic
958537653 3:95425067-95425089 CTGCAAAGCCACAGGTATATGGG - Intergenic
965710854 3:171555141-171555163 CTGGAAACCTTCCTCTATTTGGG - Intergenic
968469161 4:770375-770397 TTGCAAACCCTCATTTAAATTGG + Exonic
969895823 4:10303556-10303578 TTGGAAACCCTCATCTACCTGGG + Intergenic
974643381 4:64662908-64662930 ATGCAAGCCCTCATTTATTTGGG + Intergenic
984845742 4:184106617-184106639 CCCCAGCCCCTCATCTATATCGG + Intronic
985393740 4:189518795-189518817 TTGTAATCTCTCATCTATATTGG - Intergenic
985472525 5:54471-54493 CTGCAACCCCTCATATTCATAGG + Intergenic
987287009 5:16466620-16466642 CTGTGTACCCTCATGTATATAGG + Intergenic
987421308 5:17723675-17723697 TTGAAAACCGTCAACTATATTGG - Intergenic
990213117 5:53502002-53502024 CAGCAAATCCTTATCTGTATGGG + Intergenic
990797177 5:59556811-59556833 CTGCAAATCCTTTTCTAAATAGG + Intronic
992667639 5:79026791-79026813 CTGCATACCACCATCTACATGGG - Intronic
992887776 5:81176195-81176217 CTGCAAACCACCACCTAAATGGG + Intronic
993517049 5:88850532-88850554 CTCCATACCCTCATCTACTTTGG - Intronic
1001882426 5:175256009-175256031 CTTAAAACCCTCATCTGTAATGG + Intergenic
1003425076 6:5993794-5993816 CTGCAAACCCCCAACTAGAGTGG - Intergenic
1004446208 6:15701338-15701360 CTGCAAACCTTTCTCTTTATTGG + Intergenic
1008723452 6:54387258-54387280 CTCCAAATCCTCATCTATGCTGG - Intronic
1012974248 6:105762958-105762980 CAACAACCCCTCATCTACATTGG - Intergenic
1013631524 6:111990665-111990687 CTGCAGAGCCTCATCCTTATTGG + Intergenic
1013879308 6:114875934-114875956 CTGCAAAAACTCATCTATGAAGG - Intergenic
1022899399 7:34788491-34788513 TAGCAACCCCTCATCTATTTTGG - Intronic
1022959774 7:35415491-35415513 CTGCACACCCTCATCCATGGAGG - Intergenic
1024345771 7:48311365-48311387 TTGCAAACCCACCTCTATCTTGG + Intronic
1025733836 7:64129668-64129690 CATCAAACCATCATCTACATTGG + Intronic
1027433223 7:78135576-78135598 CCTCAAACACTCATATATATTGG - Intronic
1032840131 7:135706757-135706779 CTCCAAACATTCATCTCTATTGG - Intronic
1037437055 8:18874070-18874092 ATGAAAACCCTCATCTATGCTGG + Intronic
1037717277 8:21411113-21411135 CTGCAATCCCTCATCCATCGTGG + Intergenic
1039655656 8:39402552-39402574 TTGTAAACCCACATTTATATAGG - Intergenic
1040108720 8:43555974-43555996 CTGCAAACCCTAATATCTACAGG + Intergenic
1043634152 8:82369148-82369170 ATGCACACCCTCTGCTATATTGG + Intergenic
1046906780 8:119582042-119582064 TTTCAAAACCTCTTCTATATGGG + Intronic
1051609391 9:18946419-18946441 CTGCATAACCTCACATATATGGG + Intronic
1052310821 9:27067270-27067292 CTCCAAACCCTCTTGTATACTGG - Intergenic
1058517783 9:105793836-105793858 GTGTAAACCCTCTTCAATATAGG + Intergenic
1058517854 9:105794284-105794306 CTGTACACCCCCATCAATATTGG + Intergenic
1186053703 X:5626914-5626936 CTGCAAATCCTAATTAATATAGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1195598926 X:106724316-106724338 CTGCCAACCATCTTCTGTATGGG + Intronic
1196344886 X:114643163-114643185 CTGCAAAGACTCATTTATCTAGG - Intronic
1198440689 X:136660212-136660234 CTCCTCACCCTCATCTATAGTGG - Exonic