ID: 927585011

View in Genome Browser
Species Human (GRCh38)
Location 2:24294898-24294920
Sequence CTTCACATGCAGAAAGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927585011_927585014 -9 Left 927585011 2:24294898-24294920 CCTTACCCTTTCTGCATGTGAAG 0: 1
1: 0
2: 4
3: 12
4: 187
Right 927585014 2:24294912-24294934 CATGTGAAGACGCAGCAAGAAGG 0: 1
1: 109
2: 697
3: 1883
4: 3127
927585011_927585016 26 Left 927585011 2:24294898-24294920 CCTTACCCTTTCTGCATGTGAAG 0: 1
1: 0
2: 4
3: 12
4: 187
Right 927585016 2:24294947-24294969 AGGAGACAGCAAGCCCTCATCGG 0: 1
1: 1
2: 1
3: 22
4: 173
927585011_927585015 6 Left 927585011 2:24294898-24294920 CCTTACCCTTTCTGCATGTGAAG 0: 1
1: 0
2: 4
3: 12
4: 187
Right 927585015 2:24294927-24294949 CAAGAAGGCACTAGTTTTAAAGG 0: 1
1: 1
2: 0
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927585011 Original CRISPR CTTCACATGCAGAAAGGGTA AGG (reversed) Intronic
902158479 1:14509468-14509490 CTTCACATGCGTAAAGGCCATGG - Intergenic
904556359 1:31367442-31367464 GTTCACCTGCAGAAATGGGACGG - Exonic
905981005 1:42227269-42227291 CTGGAAATGCAGAAAGGATAAGG + Intronic
907058522 1:51396588-51396610 CATCACAAGGAGAAAGGGAAAGG + Intronic
907085603 1:51670104-51670126 GTTCACCGGTAGAAAGGGTAAGG + Intronic
909297440 1:73968573-73968595 CTTCACTTGGAGAGAGGGAAAGG + Intergenic
909894418 1:81048598-81048620 CTACTCATACAGAAAGGGAAAGG + Intergenic
910497498 1:87848634-87848656 CTTCACATGTCTAAAGGGTATGG - Intergenic
911402714 1:97396601-97396623 CTTAACATGCAGTAATGGTCAGG - Intronic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
918535032 1:185564639-185564661 CTTCTCATAGAGAAAGAGTAGGG - Intergenic
918966825 1:191361838-191361860 CTTCAGATGCAAAATAGGTACGG - Intergenic
922534726 1:226371335-226371357 CTGGACATGCAGAAATGGAAAGG - Intronic
923965531 1:239134586-239134608 CTGCACATGCAGACAGGCCAAGG + Intergenic
924070783 1:240276120-240276142 CTTCCCTTGCAGAAATGATAGGG - Intronic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
1064846479 10:19660567-19660589 TTTCACATGGAGAAAGGTGAAGG - Intronic
1069694365 10:70376019-70376041 CATCCCATGAAGAAAGGGGACGG - Intronic
1069792710 10:71033517-71033539 ATCCACATGCAGAAAGGTCACGG - Intergenic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1070464290 10:76703934-76703956 CTTTGCTTGCAGAAAGGGGAGGG + Intergenic
1071035833 10:81244102-81244124 TCTCACATGCAGAAAGGTCAAGG - Intergenic
1072991915 10:100204013-100204035 CCTCACATGCAGAAGGGATGAGG + Intronic
1074174013 10:110977533-110977555 CTAAACATGCAGGATGGGTACGG - Intronic
1074459452 10:113624137-113624159 ATTCACATGCAGAAAGGGAAAGG - Intronic
1075651454 10:124130299-124130321 CTCCACATGCTGGAAGGGGAGGG + Intergenic
1076039087 10:127227597-127227619 TTTCAGGTGCAGAAGGGGTAGGG - Intronic
1076413779 10:130270714-130270736 CTTAAGATGCAGGAAGGGAAAGG + Intergenic
1076982378 11:211517-211539 CTTCTCATGGAGGAAGGGTCTGG - Intronic
1078272286 11:9807329-9807351 ATTCAAATGCAGTGAGGGTAGGG - Intronic
1080470592 11:32541756-32541778 CATCAGATTCAGAAAGGGTTGGG - Intergenic
1081790763 11:45782431-45782453 CTTCAAATGGATAAATGGTATGG - Intergenic
1081917616 11:46743048-46743070 CTTCACATTCAGTCAGAGTAAGG - Exonic
1088145591 11:106672492-106672514 CTTCAGATGCAGCCATGGTATGG + Intergenic
1088558032 11:111082829-111082851 CTTCCCATGCAGGAGGGGTGTGG - Intergenic
1088851749 11:113708969-113708991 CTGCACAAGCAGGAAGGCTAAGG + Intergenic
1090025164 11:123161368-123161390 CTTTAAATGCAGAATGGGTTCGG + Intronic
1092293484 12:7179901-7179923 CATCACATGGTGAAAGGGCAAGG + Intergenic
1094392039 12:29962283-29962305 CTACCCAGGCAGAGAGGGTAGGG - Intergenic
1096820220 12:54227917-54227939 CTACATCTGCAGCAAGGGTAGGG - Intergenic
1099778009 12:87159019-87159041 CTTCACATGTAGATAGGTTCAGG - Intergenic
1099801599 12:87463775-87463797 GTTCACATTCACAAAGGTTAGGG + Intergenic
1104809142 12:131610115-131610137 CTTCACCTGCCCAACGGGTAGGG + Intergenic
1106103222 13:26712142-26712164 TTTTACATGCACCAAGGGTAGGG - Intergenic
1107185437 13:37513744-37513766 CCTGCCATGCAGAAAGTGTAAGG - Intergenic
1108552945 13:51564714-51564736 CTACAGATGAAGAAAGGGCAGGG + Intergenic
1110553627 13:76833918-76833940 CTACAATTGCAGAAAAGGTATGG - Intergenic
1112955085 13:105047659-105047681 CTTGAAATCCAGAAAGGGTTAGG - Intergenic
1113031371 13:105997392-105997414 GTGCAGATGCAGGAAGGGTATGG - Intergenic
1113332311 13:109341654-109341676 CTTCATCTGCAGAAAAGATATGG + Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1114719089 14:24861150-24861172 CTGCACATGATGAAAGTGTAAGG - Intronic
1116307570 14:43277706-43277728 CTTCATTTGCATAAAGTGTAAGG - Intergenic
1118444206 14:65837136-65837158 CTTCATGTGGAGAAAGGGTTTGG - Intergenic
1119181360 14:72607384-72607406 CTTCACATGGTGAAGGGGCAAGG + Intergenic
1119595465 14:75928857-75928879 TTTCCCTTGCAGAAAGGGTGGGG + Intronic
1123917757 15:25049360-25049382 TTTCACATGCAGGATGGGCATGG - Intergenic
1125146920 15:36481771-36481793 CTTCACATGGTGGAAGGGCAAGG + Intergenic
1129900852 15:79148455-79148477 CTTCACATGGAGGAAGGGTAAGG + Intergenic
1129958248 15:79659010-79659032 CCTCTCATGGAGGAAGGGTAAGG + Intergenic
1134233032 16:12443842-12443864 CTTCACTTGCAAAAAGGGTATGG + Intronic
1137486956 16:48899597-48899619 CATCACATGTAGACAGGGTAGGG - Intergenic
1138536269 16:57662004-57662026 CTACACATGGAGCAAGGGCAGGG + Intronic
1139062474 16:63270115-63270137 CTTCACAGGCAGAATGGGACAGG - Intergenic
1139524243 16:67503884-67503906 CCTCACAGGCAGATAGGGTGTGG - Intergenic
1141163615 16:81645612-81645634 CTTGACAAGCAGAGAGGGTGAGG + Intronic
1141937259 16:87249163-87249185 CTCCATTTGCAGAAAGGGCATGG - Intronic
1142482587 17:228022-228044 CTCCACCTGCACACAGGGTAGGG + Intronic
1143845757 17:9771759-9771781 CTGCACATGCACAAAGGCTGAGG + Intronic
1144169519 17:12646381-12646403 CGTCACACGGAGAAAGGGTAGGG + Intergenic
1144837055 17:18162003-18162025 ATTCAGAGGCAGGAAGGGTAAGG - Intronic
1146626463 17:34438977-34438999 CTTCAGATGCAGCAAGGCTCTGG - Intergenic
1149630485 17:58117883-58117905 CTTCACAAGCCTAAAAGGTAAGG - Intergenic
1151578625 17:74965013-74965035 CTTCCCATGGAGAGAGGGCATGG - Intronic
1152073449 17:78145297-78145319 CTGCACATGCAGGGAGGGTGGGG - Intergenic
1153016764 18:589720-589742 TCTAACATGCAGAAAGGGAAAGG - Intergenic
1154021305 18:10666172-10666194 CTGCACATGGAGTAAGGGTCTGG + Intergenic
1157866184 18:51187079-51187101 CTTAATATGCAGAAGGGGTGGGG - Intronic
1158625356 18:59066578-59066600 CCTCACATGGCGGAAGGGTAGGG + Intergenic
1162323661 19:9985890-9985912 CTTGCCCTGCAGAAAGGTTATGG + Exonic
925641853 2:5993038-5993060 CTTCTCCTGTAGAAAGGGGAAGG - Intergenic
927585011 2:24294898-24294920 CTTCACATGCAGAAAGGGTAAGG - Intronic
931972896 2:67609682-67609704 CATCACATAAAGAATGGGTAGGG + Intergenic
935697229 2:105780770-105780792 CCTCACATGCTGAAGGGGTGAGG - Intronic
940151600 2:150608445-150608467 CTTCACAAGCATGAAGAGTAAGG + Intergenic
940698146 2:157006293-157006315 CATGACATTCAGTAAGGGTAAGG - Intergenic
940704434 2:157086112-157086134 CTGCACTGGCAGAAAGGGAAAGG - Intergenic
943759085 2:191588940-191588962 CCTCACATGGAGAAAGGTCAAGG - Intergenic
943795172 2:191983503-191983525 CTTCACCTGTAGAAAGCATATGG - Intronic
943897135 2:193378489-193378511 CTTCACCTGCAGAAGATGTAAGG + Intergenic
945674558 2:212840464-212840486 CTCTCCATGCAGAAAGGATAGGG + Intergenic
1173743911 20:45421691-45421713 CTACACAGGCATAAAGAGTAAGG + Intronic
1174822420 20:53738156-53738178 CTGCACATGCAGAAATGATTAGG + Intergenic
1175168937 20:57066454-57066476 CTTAACAAGGAGAAAGGGTTTGG - Intergenic
1175742993 20:61433828-61433850 TTTCACATGTAGTAAGGTTAAGG - Intronic
1180699407 22:17773546-17773568 CTTCACCTGCAGGCAGGGTTGGG - Intronic
1182092016 22:27602431-27602453 CTTTCCAGGCAGAAAGGGCAAGG + Intergenic
1184923750 22:47623551-47623573 CATCACAGGCAGAAAGCGCACGG + Intergenic
949122798 3:407502-407524 CCTCACATTCACACAGGGTAGGG - Exonic
950335222 3:12187875-12187897 CTTCCCAGGAAGAAAGGGAAGGG - Intronic
952282336 3:31935834-31935856 TTTCATATGTAGAAAGGGAAAGG + Intronic
952685672 3:36145380-36145402 CCTCACATGGAGAAAGGGCAAGG + Intergenic
954199015 3:49013219-49013241 CTTCCCGTGCAGAGAGGGCAGGG - Exonic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
957168684 3:76709385-76709407 CACCACAGGAAGAAAGGGTAGGG + Intronic
958614304 3:96471384-96471406 CTACACATAGAGAATGGGTAAGG + Intergenic
959143011 3:102508611-102508633 CTTCACATTCTTCAAGGGTAAGG + Intergenic
959661648 3:108875184-108875206 CTTGACATGGAGAAAGAGAAAGG + Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964602602 3:158518173-158518195 ATGCAGATGCAAAAAGGGTATGG - Intronic
966268109 3:178071128-178071150 TTTCACAGGCAGAAAGGAGAAGG - Intergenic
967019230 3:185507973-185507995 CTTCACATGGGGACAGGGGATGG - Exonic
967123459 3:186404525-186404547 CCTCACATGGTGAAAGGGCAAGG - Intergenic
967871528 3:194233887-194233909 ATTCGGATGCAGAAAAGGTAGGG - Intergenic
968176812 3:196557642-196557664 TTTCAGATGCAGAAAGGGGCAGG + Intronic
970237711 4:13975402-13975424 CCTCACATGGCGAAAGGGGAAGG + Intergenic
970424385 4:15932976-15932998 CTTCAGAGGCAGAAAGGGCTTGG + Intergenic
971082285 4:23227239-23227261 ATTCACTTGCAGAATGAGTAGGG + Intergenic
973735987 4:53872188-53872210 CTCCACATGAAAAAAGGGTTGGG - Intronic
974699180 4:65417047-65417069 GTTCACATGCAGTGAGGGGACGG + Intronic
975737970 4:77400210-77400232 ATTCACATGCAGAGAGAGTCAGG - Intronic
975979637 4:80142892-80142914 CTTAAAATGTAGAAAGAGTAGGG - Intergenic
976700955 4:87967701-87967723 CTTCATCTGGTGAAAGGGTAAGG + Intergenic
980894768 4:138851523-138851545 CTTCACATTGAGAATGGATATGG + Intergenic
982112375 4:152068578-152068600 CTATACATGCAAAAATGGTAGGG + Intergenic
983541352 4:168914181-168914203 CTTGTGATGCAGAAAGGGAATGG + Intronic
983859348 4:172686114-172686136 CTCCTCATGCAGAAAGCTTAGGG + Intronic
986092059 5:4519357-4519379 CTTCACTTTCAGGAAGGGTGGGG - Intergenic
986263194 5:6167075-6167097 GTTCACATGCATGAAGAGTATGG - Intergenic
986374866 5:7120131-7120153 ATTCTCATGCAACAAGGGTAAGG - Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
987670796 5:21005121-21005143 CTACACATGCATAAAGAATAGGG + Intergenic
987770240 5:22293154-22293176 CTTCAAATGGAGCAGGGGTAGGG - Intronic
988726309 5:33929905-33929927 CTTCACTTGCAGAATGGGCTCGG + Intergenic
989013922 5:36906177-36906199 CTTCATTCGCAGAAATGGTAGGG - Intronic
990465451 5:56067244-56067266 CCTCACATGGAGAAAGGGTAAGG - Intergenic
992432380 5:76721696-76721718 CTTCACATTCTGATATGGTAGGG + Intronic
993525696 5:88963228-88963250 TTTCACATGCAAAAAGAGTATGG + Intergenic
993977347 5:94498604-94498626 CTTCTTATGCAGAAAAGGGAAGG - Intronic
997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG + Intergenic
998068287 5:139176660-139176682 CCTCACATGCAGAAGAGGCAAGG + Intronic
999816139 5:155178244-155178266 CTTCACATGGTGAAAGGGCAAGG - Intergenic
1000310416 5:160038064-160038086 TTGGACATGCAGAAAGGTTACGG + Intronic
1002449844 5:179312416-179312438 CCTCACATGCTGAAAGGGTGAGG - Intronic
1003397144 6:5763187-5763209 CTGCACAGGAAGAAAGGGCAAGG - Intronic
1004020730 6:11773937-11773959 CTTCAATAGCTGAAAGGGTAAGG - Intronic
1004330126 6:14713631-14713653 TTTCACATGGTGAAAGGGTTGGG - Intergenic
1004863778 6:19834344-19834366 GTTTACATGAAGCAAGGGTATGG - Intergenic
1005214519 6:23509606-23509628 CCTCACATGGAGGAAGGGAAAGG - Intergenic
1005363909 6:25058663-25058685 CTTCACAGGGCGAAAGGGTGAGG + Intergenic
1007517400 6:42423597-42423619 CTACAAATGCAGATAGGATATGG - Intronic
1007866819 6:44980207-44980229 AGACAAATGCAGAAAGGGTAGGG + Intronic
1009828249 6:68896635-68896657 CTTGAGAAGCAGAAAGCGTATGG + Intronic
1010131390 6:72498000-72498022 CATCATATGCAGGAAGGGTGAGG - Intergenic
1012280467 6:97321966-97321988 TTTCACATGGAAGAAGGGTAGGG - Intergenic
1012911745 6:105125755-105125777 CTTCAGATGCTAAAAGGGTATGG + Intronic
1013629192 6:111968898-111968920 CTTCTCATGCAGAAATGGCATGG - Intergenic
1014096700 6:117469191-117469213 ATTCCCATTCAGACAGGGTAAGG + Intronic
1014550167 6:122781123-122781145 GTTCACATACAGAAATGGGATGG + Exonic
1015641171 6:135334334-135334356 CTTCACAAGTGGAAAGGGCAGGG - Intronic
1016644826 6:146394515-146394537 CTCCAGAAGCAGAAAGGGCATGG - Intronic
1018038379 6:159900854-159900876 ATTCAGATGCAAAAAGGATAAGG + Intergenic
1019054035 6:169207620-169207642 CTTCACAGGTAGGAAGGGAATGG + Intergenic
1019275101 7:172108-172130 CTGCACGTGCAGACAGGGGAGGG + Intergenic
1023866288 7:44239893-44239915 CTTCTCATGCCCAAAGGGTGTGG + Intronic
1024863962 7:53881246-53881268 CTTCTTATGCAGAGAGGGCATGG + Intergenic
1026132758 7:67634047-67634069 CTGCCCATTCTGAAAGGGTATGG + Intergenic
1027597127 7:80187427-80187449 AATCACATGCAGAGTGGGTAAGG + Intronic
1029211220 7:98909750-98909772 CTGCACATGCAAAACGGATATGG + Intronic
1030618958 7:111769013-111769035 CTTCACATGGTGAAAGGGGCTGG - Intronic
1032835429 7:135668399-135668421 CTTCACATGCAATCATGGTAGGG - Intronic
1037937300 8:22923789-22923811 CTTCACATGGGGGAAGGGAAGGG - Intronic
1042305464 8:67326437-67326459 CAACACATCCAGAAAAGGTATGG - Intronic
1043651033 8:82592386-82592408 CCTCACATGTGGAAAGGGCAAGG + Intergenic
1044171770 8:89062221-89062243 CTTCACATTGAGATAGGGTAAGG + Intergenic
1044418842 8:91967857-91967879 CTTCAAATAAAGAAAGGGAAAGG + Intronic
1048493279 8:134914039-134914061 CTTCACGAGAAGTAAGGGTAAGG - Intergenic
1048658400 8:136569666-136569688 CTTCACATCCTGAAAGTATATGG - Intergenic
1050207556 9:3213165-3213187 CCTCACATGCCTACAGGGTAAGG + Intergenic
1050847942 9:10247062-10247084 CTTCACATGCATAAAATGTAAGG + Intronic
1050961724 9:11742119-11742141 CTTCATATTCAGAAAGAGTGGGG + Intergenic
1052341757 9:27370537-27370559 CTTCACATGGAGAAAGAAAAAGG - Intronic
1054785404 9:69205266-69205288 CTTCCCATGAAGAAAGGTTGGGG - Exonic
1055824697 9:80309331-80309353 CTTCATGTTCAGAAAGGTTAGGG + Intergenic
1056241659 9:84653899-84653921 CTTCACATGGAGAAAGTTTCAGG + Intergenic
1056459968 9:86800142-86800164 ACTCAAATGCAGAAAGGGTTGGG + Intergenic
1056631282 9:88295108-88295130 ATTCCCATTCAGAGAGGGTAAGG + Intergenic
1056689207 9:88791988-88792010 TTACACATGCAGAAAGTGTGGGG + Intergenic
1057126647 9:92621057-92621079 CTTCACATGGTGAAAGGGGCTGG + Intronic
1057565630 9:96164004-96164026 CCTCACTTGAAGAAAGGGCATGG - Intergenic
1057968613 9:99530488-99530510 TTTCACAGGCAGACAGGGTGAGG - Intergenic
1058548910 9:106092273-106092295 CTTCACTTGGCGAAAGGGCAAGG + Intergenic
1060521723 9:124297862-124297884 GTTCAGATGCAGAAAGGCCAAGG - Intronic
1186083695 X:5962779-5962801 CCTCACATGGAAAAAGGGTGAGG - Intronic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1187370268 X:18699667-18699689 CTTCATCAGCAGAAAGGGAAAGG - Intronic
1193537727 X:82734091-82734113 CTTCTGATGCGGTAAGGGTAGGG - Intergenic
1194680229 X:96843198-96843220 TGTCACATGGAGAAAGAGTAAGG - Intronic
1195502151 X:105613746-105613768 CTTTGCCTGCAGAAAGGGGAGGG + Intronic
1197776129 X:130119749-130119771 CTTCCCATAAAGAAAGGGAAGGG - Intergenic
1198275923 X:135096772-135096794 CTTGACATGCAGATAGGATGAGG - Intergenic
1198430751 X:136564456-136564478 CTTTGCATGTAGAAAGGGGAGGG - Intergenic
1200783486 Y:7238044-7238066 CTTCACATGGTGGAAGGGTGAGG - Intergenic
1200928104 Y:8672604-8672626 CTTCACCTGCAAAAAAGGTGAGG + Intergenic