ID: 927585368

View in Genome Browser
Species Human (GRCh38)
Location 2:24298710-24298732
Sequence GAGAACAAGAAGAAATTGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927585368 Original CRISPR GAGAACAAGAAGAAATTGTC AGG (reversed) Exonic
902141010 1:14355207-14355229 GGGAACAAGAAGGAACTTTCTGG + Intergenic
902552440 1:17227249-17227271 AAGAAAAAGAAAAAATTGGCCGG + Intronic
903402722 1:23068324-23068346 GAGAAGAAGAGGAAATTGTCAGG + Intronic
904083231 1:27885266-27885288 GAGAAAAAGCAGAAATCATCAGG - Intronic
904101112 1:28028562-28028584 AAGAAGAAGAAGAAATCATCTGG - Intronic
904864026 1:33562323-33562345 GAGAGCAAGAAGAACTTATATGG - Intronic
906652470 1:47522461-47522483 GAGAACAAGAAACATTGGTCTGG + Intergenic
906897659 1:49795082-49795104 GAGAAGAAGAAGAAAGTCACTGG + Intronic
908604240 1:65777093-65777115 GAGAAGAAAAAGAAATGGCCAGG - Intergenic
910237904 1:85054446-85054468 GAGAAAAAGAAGAAATTAAGGGG - Intronic
911024132 1:93419004-93419026 GAGAAAAAGAAAGAATTGGCAGG + Intergenic
911092601 1:94029734-94029756 GAGAATAAGAAGAAAGGGCCTGG - Intronic
911343686 1:96671693-96671715 GTGAACAATAAGAAATCATCTGG - Intergenic
914801091 1:150963118-150963140 GAGGACAAGAAGAACATGACTGG + Exonic
914982317 1:152425602-152425624 AAGAAGAAGAAGAACTTTTCAGG - Intergenic
915166444 1:153950551-153950573 GAGAACAAGAAGAAAAGGACAGG + Intronic
915177135 1:154025326-154025348 AAGAAGAAGAAGAAACTCTCTGG - Intronic
915264059 1:154702487-154702509 GAGAACAACAAGAGAATGACAGG - Exonic
916498145 1:165363989-165364011 GAGAGGAAAAAAAAATTGTCAGG + Intergenic
916983692 1:170167439-170167461 GGGAACAGGAAGAAATGGTGGGG - Intronic
919498201 1:198303495-198303517 AAAAACAAGATGAAAGTGTCAGG + Intronic
919848098 1:201654315-201654337 TGAAACAAGAAGAAAGTGTCAGG - Intronic
920250855 1:204621353-204621375 AAGAACAAGTAGGAGTTGTCTGG - Exonic
921271029 1:213470065-213470087 AATAACAATAAGAAATTGTTTGG - Intergenic
921576555 1:216841853-216841875 AAAAACAAGAAGAAAATATCTGG + Intronic
921798714 1:219377766-219377788 GAGAACAAGATGTAAGAGTCGGG - Intergenic
923592959 1:235336391-235336413 AAAAAAAAGAAGAACTTGTCTGG + Intronic
924615999 1:245612594-245612616 GTGAACAAAAAGATACTGTCAGG - Intronic
1063059119 10:2532569-2532591 GAGATAAAGAAGAAACTTTCTGG + Intergenic
1063784313 10:9363362-9363384 TAGAAGAAGAAAAAGTTGTCTGG - Intergenic
1064530468 10:16303795-16303817 GAGAACAAGCTGCAATTGACAGG + Intergenic
1064855126 10:19758932-19758954 AAAAAAAAGAAAAAATTGTCTGG + Intronic
1065632151 10:27691197-27691219 GAGAAGAGAATGAAATTGTCTGG + Intronic
1066408342 10:35141826-35141848 GAGGAAGAGAAGGAATTGTCAGG + Intronic
1066539491 10:36429959-36429981 GAGAAAGAGAAGAAATTGTGAGG - Intergenic
1068440234 10:57044806-57044828 GAGAAGTAGTAGAAATTGTTAGG - Intergenic
1068471697 10:57473490-57473512 AAGGACTAGAAGAACTTGTCAGG + Intergenic
1069258521 10:66364145-66364167 TATAACAAGAACAATTTGTCAGG - Intronic
1070018781 10:72562911-72562933 GAGAAAAAGAAGAAACGTTCTGG - Exonic
1071048793 10:81419776-81419798 GAAAACACTGAGAAATTGTCAGG + Intergenic
1071356577 10:84802472-84802494 GAGAAGAAGAAGAAATACTTAGG - Intergenic
1071810164 10:89171157-89171179 GATAAGAAGAAGAAATTATCTGG - Intergenic
1074008046 10:109447943-109447965 GATAACAGAAAGAAAATGTCAGG + Intergenic
1074571599 10:114629391-114629413 GAGAACAAGAATAAATGGAGAGG + Intronic
1074618274 10:115092783-115092805 GAGAAAAAGAAGAAATAGGCAGG + Intergenic
1075697251 10:124446303-124446325 GTGAACAAGCAGAGATTGTAAGG - Intergenic
1075954091 10:126507415-126507437 GTGAAAAAGAAGAAATAGACAGG + Intronic
1076062751 10:127426581-127426603 GAGATCAAGAAGACACTGCCTGG + Intronic
1077055505 11:590472-590494 GACAACAGGAAGAAACAGTCAGG + Intronic
1077590234 11:3485388-3485410 AAGAAAAAAAAAAAATTGTCTGG - Intergenic
1077626314 11:3774921-3774943 CAGAAAATGAAGAATTTGTCAGG - Intronic
1078047601 11:7931016-7931038 GAAAAGAAAAAGAAATTGACTGG + Intergenic
1078279608 11:9887546-9887568 AAGAACAAGAAGAAAATGAAGGG + Intronic
1078292034 11:10021506-10021528 GCGATCAAGAGGAAATTGTAGGG + Intronic
1079798184 11:24833920-24833942 GAGAAACATAAGAAAATGTCTGG + Intronic
1079833077 11:25295644-25295666 GAGGAAAAGAAGAAAGTGTAGGG - Intergenic
1080267191 11:30413861-30413883 GAGAGTTAGAAGAAATGGTCTGG - Intronic
1081417429 11:42832888-42832910 GAAGGCATGAAGAAATTGTCTGG + Intergenic
1081498441 11:43639933-43639955 GTGAAGAACAAGAAATTGCCAGG + Intronic
1082661232 11:55913781-55913803 GAGAATAGGAAGAACTTGGCCGG + Exonic
1083502318 11:63121412-63121434 GAGAATAGGAAAAAATTGTTGGG + Intronic
1085096570 11:73765390-73765412 AAGAATAAGATGAAATTGACTGG - Intergenic
1085700929 11:78745716-78745738 GAGAACAGGAAGAAAATTTTAGG - Intronic
1085757281 11:79212400-79212422 GAGAAGAAAAAGAGATTCTCAGG - Intronic
1085771342 11:79328823-79328845 GGGAAGAAGAAGAAACTGTGAGG - Intronic
1086357334 11:86016870-86016892 AATAACAAAAAGCAATTGTCTGG + Intronic
1086877038 11:92109814-92109836 TTGAATAAGAAGAAATTGGCAGG - Intergenic
1087632498 11:100666992-100667014 GAGATACAGAAGAAATGGTCTGG - Intergenic
1088200536 11:107328450-107328472 GAGAGCAAGAAGAGATTATGGGG - Intronic
1088778896 11:113114504-113114526 GTGAAGAAGAAGAAATCGTGGGG - Intronic
1088963599 11:114695694-114695716 TATAAAAAGAAGAAATTGGCCGG + Intronic
1089576474 11:119447891-119447913 GAGAGGAGGAAGATATTGTCTGG - Intergenic
1089704359 11:120266747-120266769 GAGAACAAGAAGGCACTGTAAGG - Intronic
1091032180 11:132200436-132200458 GAGAACAAGAGAAAAATCTCTGG + Intronic
1092518228 12:9238287-9238309 GGGAACAAGAAGAGATGATCAGG + Intergenic
1092633797 12:10417354-10417376 AAGAGAAAGATGAAATTGTCTGG + Intronic
1092634843 12:10432793-10432815 AAGAGAAAGATGAAATTGTCTGG + Intronic
1092635872 12:10448217-10448239 AAGAGAAAGATGAAATTGTCTGG + Intronic
1093237951 12:16635134-16635156 GAGAACAAGAAACACTTGTGAGG + Intergenic
1093309829 12:17565030-17565052 TAGAGCAAGAATATATTGTCTGG + Intergenic
1093980239 12:25467765-25467787 TAGAACCAGAAGCAATGGTCTGG + Intronic
1094178662 12:27567820-27567842 CAGATCAAGTAGATATTGTCGGG + Intronic
1095128194 12:38507220-38507242 GATAACAAGCAAAAATTTTCAGG - Intergenic
1096163297 12:49398931-49398953 GAGAAAAAGTCAAAATTGTCAGG - Intronic
1096928631 12:55178116-55178138 GAGATCAAAAAGAAATTCTGGGG - Intergenic
1097093251 12:56524572-56524594 AAGAACACAAAAAAATTGTCCGG - Intronic
1097134267 12:56838315-56838337 GAGAACCAAAAGAAATTTTGTGG - Intergenic
1097383273 12:58920364-58920386 GAGTAAAAGAAGGAATTGACCGG - Exonic
1099587146 12:84533141-84533163 GAGGGCAAGAAGAAATTCTTGGG + Intergenic
1099629615 12:85125435-85125457 AAGAACAAGAAGAAATTGACAGG - Intronic
1100045859 12:90379941-90379963 CAGAACAAGTTGAAAGTGTCAGG + Intergenic
1100315316 12:93440408-93440430 GAGAAGTAGAACAGATTGTCAGG - Intronic
1103887900 12:124216563-124216585 GAGAATAAAAAGAAAAGGTCTGG - Intronic
1104603420 12:130169212-130169234 GGGAGCAAGAAGGAATGGTCAGG + Intergenic
1105249439 13:18684701-18684723 GAGAGTGAGAAGAAATAGTCTGG - Intergenic
1107088957 13:36455281-36455303 CAGAACAAGAAGAAAATGTCAGG + Intergenic
1107140581 13:36994434-36994456 GAAAACAGGAAGAAAATGTGAGG + Intronic
1107166354 13:37285418-37285440 GAGTTAAAGAAGAAATTGCCAGG - Intergenic
1110291462 13:73812276-73812298 TAGAAGAAGAAGAAATTCTTAGG + Intronic
1110695944 13:78489020-78489042 GAAAACAAAAAGGAATGGTCAGG + Intergenic
1112459095 13:99587420-99587442 TAGAAAACAAAGAAATTGTCTGG - Intergenic
1114956710 14:27829807-27829829 GAGATCAAGAAAAAAAGGTCTGG - Intergenic
1114964828 14:27944101-27944123 GAGTACAAAAAGAAAGTGTGAGG - Intergenic
1116028728 14:39545162-39545184 GAGCACAAGAAGAACTTCTTAGG - Intergenic
1117750766 14:58921325-58921347 GGGAGCAAGAAGAAATTTTCTGG + Intergenic
1118385083 14:65249517-65249539 GAGAAAAGGAAGAGTTTGTCTGG - Intergenic
1118731559 14:68670440-68670462 GAGACCAAGAAGCAAATGTAAGG - Intronic
1119328868 14:73779088-73779110 TAGAACAAGAAGAAATAGCCGGG + Intronic
1119980862 14:79079687-79079709 GAGATCAAAAAGAAAAAGTCGGG + Intronic
1122006211 14:98705950-98705972 GAGAATAAGCAGAAATGGCCGGG + Intergenic
1122644474 14:103184371-103184393 GAGAACAACAAGAAATGGTATGG + Intergenic
1123142672 14:106095887-106095909 GAGAAAAAGAAGAGAGTGACAGG - Intergenic
1123201566 14:106670698-106670720 GAAAACAAGAGGAAATTTTGAGG - Intergenic
1123401226 15:19988860-19988882 GAGAAAAAGAGAAAATTGTGAGG - Intergenic
1124216039 15:27807720-27807742 TAAAAAAAGAAGAAATTCTCAGG + Intronic
1124941281 15:34220793-34220815 GAAAACAACAAGAAATGGTTTGG - Intergenic
1125433254 15:39619379-39619401 GAGGATAATAAGAAATTGTCTGG + Intronic
1125438359 15:39672933-39672955 AAAAACCAGAAGAAATGGTCAGG + Intronic
1126259722 15:46674392-46674414 GAGAACAAAGAGACTTTGTCAGG + Intergenic
1127685546 15:61340109-61340131 GGAAACAAGAAGAAATAATCTGG + Intergenic
1128154305 15:65383207-65383229 GAGAACAAGATGACATAGTCTGG + Exonic
1128291448 15:66481559-66481581 GAGTTCAAGAAGCAACTGTCAGG - Intronic
1128498712 15:68212277-68212299 GCAAACATGAAGAAAATGTCAGG + Intronic
1128794498 15:70455300-70455322 GACAACAAGAAAAAATAATCGGG - Intergenic
1130108850 15:80948904-80948926 GTGAAGAAGAAGAAGTTGTGAGG + Exonic
1130700114 15:86169989-86170011 GAATCCAAGAAGAAATTATCAGG + Intronic
1131358640 15:91769014-91769036 TTAAACAAGAAGAAATTTTCGGG - Intergenic
1133312724 16:4860692-4860714 AAGAAGAAGAAGAAATATTCTGG + Exonic
1135358601 16:21791834-21791856 GAGAAGAGAAAGAAATTGTGTGG + Intergenic
1135457157 16:22608270-22608292 GAGAAGAGAAAGAAATTGTGTGG + Intergenic
1135521023 16:23178364-23178386 AAGAAAAAAAAGAAATTATCCGG + Intergenic
1135922425 16:26663227-26663249 GAGGCCAAGAAGAAAGTGACAGG + Intergenic
1135959427 16:26983497-26983519 GTGGGCAAGAAGAACTTGTCAGG + Intergenic
1136781620 16:32906448-32906470 GACAACAAGAGGAAATTTTGAGG + Intergenic
1136888173 16:33947392-33947414 GACAACAAGAGGAAATTTTGAGG - Intergenic
1137011041 16:35320424-35320446 GAGAACAAACAGGAGTTGTCCGG + Intergenic
1137964077 16:52913762-52913784 GAGAAGAAAAAGAAATTTTAAGG + Intergenic
1138164982 16:54792881-54792903 GAGAATAAGAAAAAAGTGTCAGG + Intergenic
1138332394 16:56225481-56225503 GGGAACTAGCAGAAATTGTTTGG + Intronic
1138626386 16:58255254-58255276 GAGGAGCAGAAGCAATTGTCGGG + Intronic
1140328810 16:74031854-74031876 CAGGACAAGAACAGATTGTCTGG - Intergenic
1140349367 16:74247363-74247385 GAGAAAAAGAAAGAATTATCGGG - Intergenic
1140452470 16:75081766-75081788 AAGAACTAGAAGAAATTCTTGGG + Intronic
1140898441 16:79346748-79346770 GAAAACAACAAGAACTTGACAGG + Intergenic
1203084275 16_KI270728v1_random:1170430-1170452 GACAACAAGAGGAAATTTTGAGG + Intergenic
1143188744 17:5025963-5025985 GAGAACAGGATGAAAATGTGGGG - Exonic
1143764846 17:9130674-9130696 GTGAGGAAGAAGGAATTGTCTGG - Intronic
1144533422 17:16062977-16062999 GAGGTCAAGAAGAAAGTGACTGG - Intronic
1144673306 17:17145232-17145254 GAGAACAGGCAAGAATTGTCAGG - Intronic
1145371676 17:22311500-22311522 GGGAACATGAAGAACGTGTCAGG + Intergenic
1146082594 17:29794956-29794978 GAGAACAAATACAAATTGTCAGG - Intronic
1146565979 17:33913096-33913118 GAGAACTGGCAGAAATTGGCGGG - Intronic
1147343729 17:39772581-39772603 GAGAACAAGAAGAAACAGGAAGG + Intronic
1148029825 17:44611850-44611872 GGGAAGAAGTAGAAGTTGTCAGG + Intergenic
1149059299 17:52403545-52403567 GTGAACAAGGAGAAAGTGTGGGG + Intergenic
1149576297 17:57715863-57715885 GAGAAGTAGAAGAAACTCTCAGG - Intergenic
1149839551 17:59947402-59947424 GAGAAGAAACAGAAGTTGTCTGG - Exonic
1150203789 17:63384759-63384781 TAGGAGTAGAAGAAATTGTCTGG + Intronic
1150348992 17:64427600-64427622 GAGAAAAAAAAGACATTGTTTGG - Intergenic
1150590779 17:66560247-66560269 AAAAATATGAAGAAATTGTCAGG + Intronic
1151167909 17:72220344-72220366 GGAAACAAGTGGAAATTGTCGGG + Intergenic
1154439390 18:14374201-14374223 GAGAGTGAGAAGAAATAGTCTGG + Intergenic
1155226149 18:23731193-23731215 GAGCAAAAGAAAAAATTCTCTGG - Intronic
1155414140 18:25579012-25579034 GAAAACAATAATAAAATGTCAGG - Intergenic
1155589688 18:27412213-27412235 GAGAGCAAGAAAAAAATGTATGG + Intergenic
1155628193 18:27860700-27860722 GAGAAGAAGAAGAAGTTGTCTGG - Intergenic
1155650823 18:28139397-28139419 AAGAAAAAGAAGAAATTGGGTGG - Intronic
1156700641 18:39820464-39820486 GGCAACAAGAAGGAATTGGCAGG - Intergenic
1156795686 18:41043407-41043429 GAGTCCAAGAAGAGATTATCTGG - Intergenic
1157618599 18:49002372-49002394 GAGAACAAGAAGCAAATTGCAGG + Intergenic
1158902698 18:61981056-61981078 AAGAAAAAGAAAAAATTGTATGG - Intergenic
1166085202 19:40469938-40469960 TAAAAAAAGAAGAAATTGGCCGG - Intronic
925583905 2:5443413-5443435 AAGAACAAGAAGATAACGTCTGG + Intergenic
925987710 2:9229800-9229822 GAGAACATGAAGCAAGTGCCTGG + Intronic
927585368 2:24298710-24298732 GAGAACAAGAAGAAATTGTCAGG - Exonic
928044845 2:27919601-27919623 GAGAATAAGAGGAAATTGATAGG - Intronic
929059170 2:37905652-37905674 GAGTAAAAGAAGAAAGTGTATGG - Intergenic
930412242 2:51039735-51039757 GAGAACTAGAAGAAAAAGGCAGG - Intergenic
930586690 2:53275818-53275840 GATAAAAAAGAGAAATTGTCTGG - Intergenic
931018675 2:58016960-58016982 GAGAACAACAAGAAATTATAGGG + Intronic
932204306 2:69865240-69865262 AAGATAAAGAAGAAATTGTGAGG + Intronic
932208333 2:69904707-69904729 GAAAAAAAAAAGAAAATGTCTGG - Exonic
932221505 2:70003113-70003135 GAGAAAAAGAGGCAGTTGTCTGG - Intergenic
932441960 2:71743229-71743251 GAGAATATGAAAAAAATGTCAGG - Intergenic
932736361 2:74257314-74257336 GAGAAAAAGCAGGAATTGACAGG + Intronic
933146828 2:78863879-78863901 AAGAAAAAGAAAAAAATGTCAGG + Intergenic
933919348 2:87028839-87028861 GGGAATAAGATGAAATTGGCTGG + Intergenic
934003646 2:87741068-87741090 GGGAATAAGATGAAATTGGCTGG - Intergenic
934029991 2:88035484-88035506 TAGAATAAAAAGAAAATGTCTGG + Intronic
934042011 2:88135290-88135312 AAGAGCAAGAAGAAATTTTCTGG + Intergenic
934514022 2:94973192-94973214 GAGAAAAAGAGAAAATTGTGAGG - Intergenic
934875989 2:97921067-97921089 GAGAAGAATAACAAAGTGTCAGG + Intronic
935426315 2:102921808-102921830 GAGAACACAAAGGAGTTGTCAGG - Intergenic
935873766 2:107483981-107484003 AAGAAGAAGAAAAAATTGTCAGG - Intergenic
938134645 2:128745649-128745671 GAAAACAAAAAGAAATTCTAAGG + Intergenic
938265499 2:129925248-129925270 TAGAAGAAGATGAAATTATCTGG + Intergenic
939103564 2:137924169-137924191 GAGAGTGAGAAGAAATAGTCTGG - Intergenic
939797659 2:146666857-146666879 GAAAACAAAAAGAAATTAACAGG + Intergenic
940613285 2:156018159-156018181 GAAAACAAGGAGAAGTTGTTTGG - Intergenic
942184478 2:173411705-173411727 CAGCACCAGAAGAACTTGTCAGG - Intergenic
942192451 2:173483579-173483601 GATAAAAAGAAGAAATATTCAGG + Intergenic
942620753 2:177843049-177843071 GAGAAAGAGAAGAAATTTTAAGG + Intronic
942848967 2:180460147-180460169 GATAACTAGAAGAAATTATCTGG - Intergenic
943434243 2:187844165-187844187 ATGAACAAGAAGAAACTGTGGGG - Intergenic
943536667 2:189160780-189160802 AAGTACATGAAGAAATTCTCAGG - Intronic
944309250 2:198214890-198214912 GAGAATAAAAAGAATTTGACAGG + Intronic
945539334 2:211064896-211064918 GAGAACAAAAAGAATATGGCAGG - Intergenic
946008859 2:216548775-216548797 GAGAACAGAAAGAACTTCTCAGG - Intronic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1169582227 20:7036522-7036544 GAGAAAGAGAACAATTTGTCTGG + Intergenic
1169946258 20:10992198-10992220 GAATACAAGAATTAATTGTCAGG + Intergenic
1170851795 20:20011465-20011487 GAAAAGAAGAAGAAATAGCCAGG - Intergenic
1172389391 20:34556558-34556580 GAACACAAGGAGAAATTGCCAGG - Intronic
1174024218 20:47559304-47559326 GAGAACAAGAAGCCTTTTTCTGG - Intronic
1174750093 20:53103473-53103495 CAAAACTAGAAGAAATTGTTTGG + Intronic
1175557639 20:59881720-59881742 GAGAAAAACAAGCAATTGTGGGG - Intronic
1175848834 20:62075924-62075946 GAGAAAAAAAAGAAAATTTCAGG + Intergenic
1176456292 21:6915207-6915229 GAGAGTGAGAAGAAATAGTCTGG - Intergenic
1176657520 21:9601235-9601257 GAGTACAATAAAGAATTGTCTGG - Intergenic
1176834466 21:13780267-13780289 GAGAGTGAGAAGAAATAGTCTGG - Intergenic
1176919335 21:14668239-14668261 AACAACAAGAAGAAAATTTCAGG + Intergenic
1177123132 21:17163455-17163477 AAGAAGAAGAAGAAATAGTTTGG + Intergenic
1178947568 21:36960605-36960627 GTAAACAAGAAGTAATTGACTGG - Intronic
1179019730 21:37627619-37627641 AAGAACAAAAAGAAATTCTGGGG + Intronic
1179269135 21:39836075-39836097 GAGAAGAAGAAGAAAGTTTGGGG + Intergenic
1181416982 22:22767327-22767349 GAGAATGAGAAGACCTTGTCTGG - Intronic
1183827984 22:40403610-40403632 GAGAGCAAGAGGAAAATGGCAGG + Intronic
1183836944 22:40461979-40462001 GAGAAGAAAAAGCAAGTGTCTGG - Intronic
1184394939 22:44228642-44228664 GAGAACATGCACAAATTGACAGG - Intergenic
951025963 3:17830192-17830214 GACAAGAAGAAGAAATGGTCTGG - Intronic
951289708 3:20860834-20860856 GAAAACAAGAAGAAAGTGGTGGG + Intergenic
951402936 3:22257044-22257066 GATAAAAAGAAGAAAATTTCTGG + Intronic
954109706 3:48427218-48427240 GACAACAGGAAGAAATGGGCGGG + Intronic
954944031 3:54401492-54401514 AAGAACAAGAGAAAAGTGTCAGG + Intronic
955058730 3:55478262-55478284 GAGAACAAAAAAGAGTTGTCAGG - Intronic
955604821 3:60690173-60690195 GAGCAACAGAAGAAATGGTCTGG + Intronic
956231521 3:67022027-67022049 GAGACCCAGAAGACATTTTCTGG - Intergenic
956750549 3:72340940-72340962 GAAAACAGGAGGAAATTTTCTGG + Intergenic
956879990 3:73500598-73500620 TAGAACAAGAAGGCATTGTTGGG - Intronic
957627484 3:82672257-82672279 GAGAAGAATAAGGAAATGTCTGG - Intergenic
957741580 3:84277462-84277484 GAGAAACAGAATAAATTTTCTGG - Intergenic
958712268 3:97731816-97731838 GAGGAGAAGAAGCAATTCTCGGG - Intronic
959497100 3:107064382-107064404 GAGAATAAGGAGAAATGGTAAGG + Intergenic
960301223 3:116005267-116005289 GAGATCAATAATAAATTTTCTGG + Intronic
961106553 3:124247733-124247755 GAGAGAAAGAAAATATTGTCTGG - Intronic
961587630 3:127946912-127946934 GAAAAGAAGAAGAAAATGGCTGG - Intronic
963775367 3:149433713-149433735 TAGAAGAAAAAGAAATTATCAGG - Intergenic
964105263 3:153032522-153032544 GTGAACAAGAAAAGATTATCTGG - Intergenic
964236489 3:154536189-154536211 GAAAAAAAGAAGAAGTTGCCGGG - Intergenic
965127118 3:164645784-164645806 GTGAACAACAAGAAATAGTGTGG + Intergenic
965589289 3:170347464-170347486 AAGAAAAAGAAAAAAATGTCAGG - Intergenic
966306434 3:178540777-178540799 GAGAAAAAGAAAGCATTGTCTGG - Intronic
966621242 3:181966550-181966572 GAGAAAAAGAAGAGACTGTGGGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967675915 3:192298905-192298927 GAGAACAAACAGAACATGTCAGG + Intronic
968038172 3:195566223-195566245 GACAACAAGAAAAAATTGCAAGG - Intergenic
968892927 4:3380947-3380969 GAAAAGAAGAAAAAATTTTCTGG - Intronic
970318854 4:14855951-14855973 GAGAACCAGGAGCAGTTGTCAGG + Intergenic
970903215 4:21184442-21184464 GAGGAGGAGAAGAAATTTTCAGG + Intronic
972706787 4:41552541-41552563 GAGAACAAGAAGCAAGAGACAGG - Intronic
974058038 4:57003864-57003886 AAGAAGAAGAAGAAATAGTTGGG + Intronic
974919709 4:68223804-68223826 GAGAACATGAAGATATTTTCAGG + Intergenic
975405406 4:73982784-73982806 GAGGACAAGAAGAGTTTGCCAGG + Intergenic
975936828 4:79591664-79591686 GGGAAAAAGAAGAAAATTTCTGG - Intergenic
976481466 4:85551478-85551500 AACAACAAAAAGAAAATGTCAGG - Intronic
976488775 4:85642003-85642025 GAGATCAAGAAGACATTGAATGG - Intronic
977791033 4:101103490-101103512 GACATGAAGAAGAAATTGCCTGG - Intronic
978445605 4:108777310-108777332 GTGGGCAAGAAGAACTTGTCTGG - Intergenic
978563826 4:110061255-110061277 GTGAACAAGAAGAGAATGGCAGG - Intronic
978708008 4:111740074-111740096 GAAAATAAAAAGAAAGTGTCTGG + Intergenic
978904823 4:113993666-113993688 GAGAACAAGAGGGGACTGTCTGG - Intergenic
980597997 4:134980875-134980897 GAGAAAAAGAAGAAGTAATCAGG - Intergenic
981589359 4:146340861-146340883 GAGAGCAAGAAGCAATCATCTGG + Intronic
982237016 4:153261118-153261140 GAGAACAATAAAAAATGGGCTGG + Intronic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
984138277 4:175969547-175969569 GAAAAAAAGAAAAAATTATCTGG + Intronic
984232291 4:177113863-177113885 GAGAATAAGAAAAAATTATCAGG + Intergenic
985054859 4:186027305-186027327 GCCAGCAAGAAGAAACTGTCTGG - Intergenic
985286627 4:188342955-188342977 GAGAGCAAGAAGGAACTGTAGGG + Intergenic
985904563 5:2823314-2823336 GACAAGAAGAAGAACTTCTCTGG + Intergenic
986650596 5:9959706-9959728 GAGAAAAAGAAGAGATTGCAGGG - Intergenic
986827606 5:11539111-11539133 GACAAAAAGATGAAAATGTCAGG + Intronic
986979201 5:13427404-13427426 AAGCACAAGAAGAAATTAGCCGG + Intergenic
987384672 5:17318001-17318023 GAGAAGAAGAAGGCAGTGTCAGG + Intergenic
987972637 5:24968055-24968077 GAGAACAACAAAAAACTTTCAGG - Intergenic
988111073 5:26820897-26820919 GAGAACAAGAGCAGACTGTCTGG + Intergenic
988158462 5:27486742-27486764 GATTATAAGAAGAAAATGTCAGG - Intergenic
988765827 5:34375027-34375049 GAAAAAAAGAAGAAATTGGAAGG + Intergenic
989107505 5:37877640-37877662 GAGAACAAGAACAAACTTTTTGG + Intergenic
989187713 5:38641238-38641260 TAGGACAAGAAGAAAATCTCGGG + Intergenic
989590906 5:43112094-43112116 GAAAACAAAAAAAAATTGGCTGG - Intronic
991218675 5:64186479-64186501 GAGAACAGGCAAAAATTGTCAGG - Intronic
991646557 5:68806987-68807009 AAGTACAAGAAGAAATTGACAGG + Intergenic
992040729 5:72828215-72828237 GAGGCCAAGAAGAAGTTGTTGGG + Intronic
992328308 5:75685958-75685980 AAGAACAAAAATAAATTGTTAGG - Intronic
992959614 5:81945831-81945853 GTGAACAAGAAGAACCTGTTGGG - Intergenic
993750004 5:91653706-91653728 GAGAAGAGAAAGAAATAGTCTGG + Intergenic
994554077 5:101275174-101275196 AAGAACTGGAAGAAATTGTAAGG - Intergenic
994933679 5:106222763-106222785 GAGAACAAAATGTAATTTTCAGG + Intergenic
995036095 5:107536141-107536163 TAGAACAAGGAGTAATTGTATGG - Intronic
995345244 5:111106901-111106923 TAGAACAAGTAGAAATTACCTGG - Intronic
995762895 5:115582713-115582735 AAGAACAAGTAGAAATGCTCTGG - Intronic
996137790 5:119866388-119866410 GACAAACAGAAGAAATTCTCTGG + Intergenic
998323052 5:141250697-141250719 GACAAAATGAAGAAATTGACAGG + Intergenic
999659096 5:153840177-153840199 GAGAATAGAAAGAAATAGTCAGG - Intergenic
1000495337 5:161975932-161975954 CAGAAAAAAAACAAATTGTCTGG + Intergenic
1000649054 5:163793287-163793309 GACACCAAGAGGAAATTATCAGG - Intergenic
1000813972 5:165897847-165897869 AAGAACAATAAGAAATAGTTGGG + Intergenic
1002555556 5:180036267-180036289 TAGAACAAGAAGAAACTGAGTGG - Intronic
1002680703 5:180960987-180961009 AAGAAAAAGAAAAAACTGTCAGG - Intergenic
1002701800 5:181129963-181129985 GAGAACGAGAAGAAAGAGTGAGG + Intergenic
1003276115 6:4654798-4654820 GAGAACAAGAAAAAACTCTTTGG - Intergenic
1003432294 6:6050787-6050809 GAGAACAAGAAAGAACTCTCAGG - Intergenic
1003508147 6:6756841-6756863 AAGAAAAAGAAGAAATTTTGTGG + Intergenic
1003729645 6:8807181-8807203 GAGAACTAGAAGGAAATTTCAGG - Intergenic
1004079152 6:12373954-12373976 GAAAACAAGACCAAATTATCAGG - Intergenic
1005000081 6:21231586-21231608 GAAAACACAAAAAAATTGTCTGG - Exonic
1005011613 6:21341182-21341204 GACAAGAAGAAGAAAGAGTCTGG + Intergenic
1005979187 6:30823371-30823393 AAGAAGAAGAAGAAATGGGCTGG - Intergenic
1006607057 6:35265527-35265549 AAGAAGAAGAAGAAAATGCCAGG + Intronic
1006752306 6:36386475-36386497 GAGAAAATGAAGAAAGTGGCAGG + Intronic
1006905637 6:37531556-37531578 GAGAAAAAGAAGAATGTGTTTGG + Intergenic
1007686151 6:43668489-43668511 GAGAGCAAGGAGAAACTGGCAGG - Intronic
1007734899 6:43975522-43975544 GAGAAAAAGAATAAAGTGTGAGG - Intergenic
1009270537 6:61608367-61608389 GAGAAGAAGAAGCAATTCTATGG + Intergenic
1009297125 6:61965463-61965485 GATAAAAAGAAGAAACTGTAGGG - Intronic
1009298311 6:61982772-61982794 CAGAACAAGAAGTAATTATATGG + Intronic
1009625338 6:66133404-66133426 GAGAATAAGAAGAATTTATTTGG - Intergenic
1009711018 6:67320755-67320777 GAAAACAAGAGTAAATTGTCAGG - Intergenic
1010131913 6:72504137-72504159 GAGAAAAAGTAGGAATTTTCTGG - Intergenic
1010273029 6:73936391-73936413 GAGAAGTAGTAGAAATTGTCAGG + Intergenic
1010720723 6:79280440-79280462 GAGACCAAGAAGGAACTGTCAGG + Intergenic
1010786707 6:80010936-80010958 GAGGAAAAGAAGAATTTATCAGG + Exonic
1010996166 6:82535662-82535684 GAGAATGAGAAGAAATAGCCAGG + Intergenic
1011523351 6:88235839-88235861 GAGATCATGAAGAAATGGTAAGG - Intergenic
1012889486 6:104882422-104882444 CAGAGCAAGAAGAGATTGACAGG - Intergenic
1013166384 6:107596649-107596671 TAGAACAAAAAGCAATTTTCTGG - Intronic
1013487939 6:110616188-110616210 GCGAGCAAGAAGAACCTGTCGGG + Intronic
1014712915 6:124829661-124829683 GGATTCAAGAAGAAATTGTCTGG + Intergenic
1014941607 6:127446947-127446969 TAGAACAGATAGAAATTGTCAGG - Exonic
1015343084 6:132124684-132124706 GTGAATAAGTAGATATTGTCAGG - Intergenic
1015359563 6:132323093-132323115 GATAACATGTAGAAATGGTCTGG - Intronic
1018127427 6:160695228-160695250 GGGAATAAGATGAAATTGCCTGG - Intergenic
1018535509 6:164814543-164814565 GAAAAAAAGAAGACATTTTCTGG - Intergenic
1018880064 6:167868922-167868944 AAGAAGAAGAAGAAATTAGCCGG - Intronic
1019507773 7:1401576-1401598 GTGGACAAGAAGAACTCGTCAGG + Intergenic
1019869717 7:3748891-3748913 AACAACAACAAAAAATTGTCTGG - Intronic
1023252258 7:38277377-38277399 GAGGACAAGAAGAGATTGAGCGG - Intergenic
1023521936 7:41058137-41058159 AAGAACAAGAAAAAATCATCAGG - Intergenic
1024146938 7:46526716-46526738 AAGAAAAAAAAGAAATTGTTTGG + Intergenic
1024172724 7:46807072-46807094 GAGAACAAGAATAAATGTTCTGG - Intergenic
1024967164 7:55033910-55033932 GAGCACAGGAAGAAATCATCAGG - Intronic
1027519767 7:79191364-79191386 GAAAAAAAGAAGAAATGCTCAGG - Intronic
1027612002 7:80373191-80373213 GAGAAAAAGAATAAAATATCAGG - Intronic
1028636298 7:92993434-92993456 GAGAACAAGAAGAAAGGGAGGGG + Intergenic
1029916959 7:104220295-104220317 GTGGACAAGAAGAACCTGTCAGG - Intergenic
1030010374 7:105160284-105160306 GGGAACAACATGTAATTGTCAGG - Intronic
1030369396 7:108680811-108680833 GAGAACAAGCAGAACTTCTTGGG + Intergenic
1030991691 7:116308858-116308880 GAAAAAAAGAAGAAAATGCCCGG + Intronic
1031728518 7:125267467-125267489 GAAAACAAGAAGATATTTTCTGG - Intergenic
1032065802 7:128769568-128769590 GAGATCAATAAGAAATGTTCAGG + Exonic
1032968830 7:137134768-137134790 CACAACAAAAAGAAATTTTCAGG + Intergenic
1033204030 7:139401436-139401458 GAGGACATGAAGAAATGTTCAGG - Intronic
1033396784 7:140982181-140982203 GAGAACTGAAAGAAATGGTCTGG + Intergenic
1034712564 7:153206795-153206817 GAGAGGAAGAATAAAATGTCAGG - Intergenic
1035739665 8:1916776-1916798 GAGAACAAGAATTAATTCCCAGG - Intronic
1036448446 8:8843648-8843670 GAGAAAAAGAAGAAAGTGAAAGG + Intronic
1038722148 8:30046758-30046780 GAGAATAAGAAGAAATAATAAGG - Intergenic
1038815585 8:30900249-30900271 GAGAATAAAAAGAAATAATCAGG + Intergenic
1039040480 8:33403417-33403439 GAGAAAAAGAAGTTATTGGCTGG + Intronic
1039191111 8:34976213-34976235 GAGAAAGAAAAGAAATTTTCTGG + Intergenic
1039950222 8:42165236-42165258 TAGAACAAGAAGAAATAATTAGG + Intronic
1040699554 8:50044680-50044702 GAAAACAAGAAGAAATTCCAAGG - Intronic
1041126269 8:54643328-54643350 GAGAACATGAAGAAACTATTTGG - Intergenic
1041865392 8:62567370-62567392 CAGAGCAAGAAGAAATGGTGTGG + Intronic
1043183271 8:77111885-77111907 GAGAACAGGAAGAAATAATTTGG + Intergenic
1043662039 8:82755629-82755651 GAGGAGAAGAAGCAAGTGTCTGG - Intergenic
1043809524 8:84719405-84719427 GAGAACAAAAAGGACTTGGCAGG - Intronic
1044748380 8:95393381-95393403 GGGAATAAGAAGAAACTTTCAGG + Intergenic
1044794211 8:95880039-95880061 GGGAACAGGAAGAAATGGCCAGG + Intergenic
1045104631 8:98879653-98879675 GAGAAAAAAAAGAAAAAGTCAGG - Intronic
1045873239 8:106949559-106949581 CAGAAAAAGAACAAAGTGTCTGG + Intergenic
1046108435 8:109693071-109693093 GAAAAGAAAAAGAAATTGTTGGG - Intergenic
1046184228 8:110691902-110691924 CACAACAGGAAGAATTTGTCAGG - Intergenic
1047131179 8:122021738-122021760 GAAAAGTAGAAGAAATTGACAGG + Intergenic
1047820299 8:128512323-128512345 GACAACAGGAAAAAATTCTCTGG - Intergenic
1047940599 8:129824602-129824624 GAACACAAGAAGAAAAAGTCAGG + Intergenic
1048087135 8:131195751-131195773 GGGAAAAAGAAGAAAATGTGGGG - Intergenic
1048207299 8:132425444-132425466 GAGATAAAGAAGAAAATGTATGG + Intronic
1048304298 8:133272874-133272896 GAAAACAAGAAGCAACTGTGTGG + Intronic
1048734349 8:137482038-137482060 GAGAACATGTAGAATTTTTCAGG + Intergenic
1050305984 9:4306486-4306508 GAGAACATGTAGAAATGGCCTGG - Intronic
1050335607 9:4587472-4587494 GATAACAAGAAGAAAAAGGCAGG - Intronic
1050940678 9:11453077-11453099 GATCCCAAGAAGATATTGTCAGG + Intergenic
1050994003 9:12190551-12190573 GAGAATAAGCAAAAATTGTTGGG - Intergenic
1051108959 9:13613280-13613302 GAGAAGATAAAGAATTTGTCAGG + Intergenic
1051149047 9:14060993-14061015 TAGAACAAGAAGAAACTTCCAGG + Intergenic
1051794361 9:20848286-20848308 GAGACCAAGAAGAATTTAACTGG - Intronic
1051798814 9:20907781-20907803 GAGAACAAGTAGAAATTAGGTGG - Intronic
1051998126 9:23244274-23244296 GAGTACAAGAAAATATGGTCAGG - Intergenic
1053831636 9:42088370-42088392 GAGAACAAGAAATATTTGGCTGG - Intronic
1054598910 9:67099078-67099100 GAGAACAAGAAATATTTGGCTGG + Intergenic
1054979026 9:71182450-71182472 GGGAAGAAAAGGAAATTGTCAGG - Intronic
1055256953 9:74383132-74383154 AAGAAGGAAAAGAAATTGTCAGG - Intergenic
1055492709 9:76822510-76822532 GAGAAAAAGAAGAATAGGTCGGG + Intronic
1055797347 9:79989114-79989136 GAGAAAAAGAGGAAGCTGTCAGG - Intergenic
1056401997 9:86237032-86237054 GAGAACAAGAAGAAATAATTAGG + Intronic
1056657614 9:88522196-88522218 GAGAAAAAGAAGAAAATGAGAGG - Intergenic
1057528839 9:95826410-95826432 TAGAACAAGAAGAAATATTCTGG - Intergenic
1058349925 9:104009458-104009480 GAGAGGAAGGAGAACTTGTCAGG - Intergenic
1059938908 9:119338731-119338753 AAGAAGAAGAAGAAATTAGCCGG + Intronic
1203635245 Un_KI270750v1:104809-104831 GAGTACAATAAAGAATTGTCTGG - Intergenic
1185715349 X:2337358-2337380 GAGAACGATATGAAATTGCCTGG - Intronic
1185887092 X:3792585-3792607 GAGAAAAAGAAAAAATTGGAGGG + Intergenic
1188713670 X:33433692-33433714 GATACCAAGAAAAAATTGTCAGG - Intergenic
1189463734 X:41262651-41262673 GAAAAAAAAAAGAAATTATCTGG - Intergenic
1190437041 X:50435825-50435847 GAGAGCAGGAGGAAAGTGTCAGG + Intronic
1192075084 X:67985761-67985783 GAGAAGAAGAATGTATTGTCAGG - Intergenic
1192154375 X:68732981-68733003 AAGCACTAGAAGAAATTGTTGGG + Intergenic
1192199088 X:69052791-69052813 GAGAGAAAGAAGAGAGTGTCAGG - Intergenic
1193004859 X:76604917-76604939 GTGAAAAAGAAGAAAATATCTGG - Intergenic
1193342423 X:80365248-80365270 GAGATCAGGAAAAAATTGTAAGG + Intronic
1193584828 X:83308028-83308050 GATAAAAAGGAGAAGTTGTCTGG + Intergenic
1194073406 X:89356634-89356656 GACGACAAGAAGATATTCTCAGG + Intergenic
1194363406 X:92983464-92983486 GAGACGAAGAAGAAATTTTGGGG - Intergenic
1194585217 X:95724522-95724544 CAGAACAAGAAGAAATTGAGAGG - Intergenic
1194739324 X:97553687-97553709 AAGAAGAAGAAGAAAATGGCTGG + Intronic
1194935857 X:99947902-99947924 GAGAACTAGAATAAATTCTATGG + Intergenic
1194967353 X:100303773-100303795 GAGAACAAAAAGAAAGTTTTAGG - Intronic
1196551074 X:117025949-117025971 AGCAACAAGAAGAAAATGTCAGG - Intergenic
1197306855 X:124853208-124853230 GAGAAAAGGAAGTAATTGTGTGG + Intronic
1197863107 X:130991119-130991141 GGGAACAAGATTAAAATGTCAGG + Intergenic
1198097168 X:133391422-133391444 TAGAACAAGAAGAGAAGGTCTGG + Intronic
1198878906 X:141257518-141257540 GAGATCAAGAAGAAATGGAAGGG + Intergenic
1199074056 X:143510222-143510244 GAGAACAAGCAGAAATAGAAAGG - Intronic
1199907869 X:152253107-152253129 GAAACCAGGAAGAAAATGTCAGG - Intronic
1200671642 Y:6099709-6099731 GAGATGAAGAAGAAATTTTGGGG - Intergenic
1200728789 Y:6708212-6708234 GACGACAAGAAGATATTCTCAGG + Intergenic
1201515615 Y:14816344-14816366 GAGAAAAGGTAGAAACTGTCAGG - Intronic