ID: 927587237

View in Genome Browser
Species Human (GRCh38)
Location 2:24318851-24318873
Sequence CGCTCACCTTCTGTGCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 1, 2: 11, 3: 52, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927587237_927587242 7 Left 927587237 2:24318851-24318873 CCTGGCCGCACAGAAGGTGAGCG 0: 1
1: 1
2: 11
3: 52
4: 132
Right 927587242 2:24318881-24318903 AGTGAGCACTACCACCTGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 76
927587237_927587245 28 Left 927587237 2:24318851-24318873 CCTGGCCGCACAGAAGGTGAGCG 0: 1
1: 1
2: 11
3: 52
4: 132
Right 927587245 2:24318902-24318924 GGCACCTCCTGTCAGATCAGTGG 0: 1
1: 14
2: 321
3: 605
4: 912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927587237 Original CRISPR CGCTCACCTTCTGTGCGGCC AGG (reversed) Intronic
900140620 1:1138038-1138060 GGCTCACGTCCTGTGTGGCCTGG + Intergenic
900281880 1:1875109-1875131 CTCTCACCTGCTGTGCAGCCCGG + Intronic
900343162 1:2198257-2198279 CGATCACCTTCTGCTCTGCCTGG - Intronic
900391863 1:2437067-2437089 CTCTCGCCTTCTGTGGGGCAGGG + Intronic
900722908 1:4189453-4189475 AGCTCACCTGATGTGCGGCCTGG + Intergenic
902862424 1:19256036-19256058 CGCTCACCGGCTGTGCTTCCAGG - Exonic
905140757 1:35842207-35842229 CACTCACCTGCTGTGCAGCCTGG - Intronic
906238923 1:44229616-44229638 CCGTCACCATCAGTGCGGCCTGG + Intronic
907160521 1:52365907-52365929 TGCCCACCTTCCGTGAGGCCTGG - Intronic
907481113 1:54746121-54746143 CACTCAACTGCTGTGCGGCCTGG - Intergenic
908543851 1:65146566-65146588 CCCTCACCTTCTCTGAGTCCTGG + Intergenic
912532429 1:110335934-110335956 CCCTCACCTGCTGTGCAGCCAGG - Intergenic
918428897 1:184438061-184438083 CACTCACCTGCTGTGGGGCTTGG + Intronic
919801433 1:201356945-201356967 AGCTCACCTGCTGTGCAGCCTGG - Intergenic
920553599 1:206886417-206886439 CACTCACCTTTTGTGCAGCCTGG - Intergenic
921488199 1:215740980-215741002 CACTCACCTGCTGTGTGGCCCGG + Intronic
1062931478 10:1355334-1355356 AGCTCAGCTTCTGTGGGGCTGGG - Intronic
1063965632 10:11344083-11344105 CTCTCACCACCTGTGCGCCCAGG - Intergenic
1065666146 10:28063563-28063585 CGCTCACCTTCTGTGTGGCCTGG - Intronic
1067323063 10:45240555-45240577 CTGTCACCTTCTGCCCGGCCTGG - Intergenic
1073469442 10:103713792-103713814 CCCCCACCTGCTGTGTGGCCTGG - Intronic
1074794825 10:116932259-116932281 TGCTAACCTTCTGTGCAGCCTGG - Intronic
1075682270 10:124341463-124341485 CGGGCAGCTTCTGTGCAGCCCGG - Intergenic
1076621204 10:131789243-131789265 TGCTCACCTGCTGTGTGGCCTGG - Intergenic
1076667978 10:132103552-132103574 CACTTTCCTTCTGTGCTGCCAGG - Intergenic
1078062207 11:8055560-8055582 CACCCAGCATCTGTGCGGCCAGG - Intronic
1078840713 11:15073802-15073824 CGCTCGCCTTCTACGGGGCCTGG - Intronic
1084557106 11:69881796-69881818 CGCTCAGCCTCTGTGTGGCCAGG + Intergenic
1084973305 11:72782798-72782820 AGCTCAACTTCTCTGAGGCCAGG + Intronic
1085190862 11:74621192-74621214 TGCTCACCTCCTGTGCCACCCGG - Intronic
1089189482 11:116643764-116643786 CACCCACCTTCTGTGTGGCCAGG - Intergenic
1089685219 11:120142269-120142291 CACTTACCTACTGTGTGGCCTGG + Intronic
1089854791 11:121533773-121533795 CTCTCTCCTTCTCTGAGGCCAGG - Intronic
1094021986 12:25924633-25924655 CTCTCAACTTCTATGGGGCCAGG + Intergenic
1095690314 12:45081124-45081146 CCCTCACCTTGTGTGTGGGCTGG - Intergenic
1095950581 12:47779738-47779760 CCCTCACCTGCTGTGTGGCCTGG - Intronic
1097032134 12:56097374-56097396 CGCTCACATGCTCTGTGGCCTGG - Intronic
1097580892 12:61455012-61455034 CACTCTCCTGCTGTGCAGCCTGG + Intergenic
1098140488 12:67445654-67445676 TGCTCACCTGCTGTGCAGCCTGG + Intergenic
1105607445 13:21938082-21938104 CGCTCACCTTCTGTGGCTCCAGG - Intergenic
1110072569 13:71195690-71195712 CTCTCACTTTCTGTGTGGCTAGG - Intergenic
1111504059 13:89163195-89163217 CACTCATCTGCTGTGCGGCCGGG - Intergenic
1117691628 14:58313491-58313513 CGCTAACCTGCTGTCCGGTCCGG + Intronic
1118324051 14:64769583-64769605 CCCTCACCTCCTCTGAGGCCTGG + Exonic
1119749585 14:77067945-77067967 CGCTTACCAGCTGTGTGGCCTGG - Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1122356928 14:101128648-101128670 CGGTCACCCTCAGTGGGGCCAGG - Intergenic
1123481715 15:20638593-20638615 CGCTCACCTGCTGTGCTGCCTGG + Intergenic
1123636298 15:22361772-22361794 CGCTCACCTGCTGTGCTGCCTGG - Intergenic
1126038005 15:44565519-44565541 TGCTCACTTGCTGTGCGGCCTGG + Intronic
1126457029 15:48874404-48874426 TGCTCACCTCCTCTGCAGCCCGG - Intronic
1126546976 15:49884765-49884787 CACTCACCTGCTGTGAGGCCTGG - Intronic
1128983372 15:72201939-72201961 GGCTGACATTCTGTGGGGCCTGG - Intronic
1129115544 15:73363455-73363477 CACTCACCTTCTCTGGAGCCTGG - Intronic
1129499458 15:76022097-76022119 TGCTCACCTGCTGTGTGGCCTGG + Intronic
1130005634 15:80094260-80094282 CGCTCCCCTGCTGTGCAGCCAGG - Intronic
1130085885 15:80778412-80778434 CGCTAACCTACTGTGTGACCAGG - Intergenic
1132759068 16:1500220-1500242 GGCTCACCTTTTGGGCGGCAGGG + Intronic
1135804935 16:25534271-25534293 CACTCACCTGCTGTGCAGCCTGG + Intergenic
1136748620 16:32613994-32614016 CTCTCACCGTCTGTGTAGCCTGG + Intergenic
1138263825 16:55645110-55645132 CACTCAACTTCTGTACTGCCTGG - Intergenic
1141170168 16:81685994-81686016 CTCTCACCAGCTGTGTGGCCTGG + Intronic
1141604537 16:85145336-85145358 CTCTCACCAGCTGTGCGCCCCGG + Intergenic
1142017194 16:87755938-87755960 AGCTCACCTTCCCTGCAGCCCGG - Intronic
1203050753 16_KI270728v1_random:873208-873230 CTCTCACCGTCTGTGTAGCCTGG + Intergenic
1142863448 17:2776932-2776954 CACTGACCTTCTGCGCCGCCTGG - Intergenic
1144672715 17:17142022-17142044 CGCTCTCCTGCTGTGCCGCTGGG + Intronic
1144949456 17:18986074-18986096 CGCTGACCTGCTGTGGGTCCTGG - Intronic
1146168484 17:30612493-30612515 CTCACTCCTGCTGTGCGGCCTGG + Intergenic
1146221452 17:31025993-31026015 CTCACTCCTGCTGTGCGGCCTGG + Intergenic
1146967691 17:37046838-37046860 GTCTCACCTTCTGTGCGGCTGGG + Intronic
1147012447 17:37461284-37461306 TGCTCACCTGCTGTGCAGCCTGG + Intronic
1150220848 17:63495222-63495244 CCCTCTCCTTCTGTGTGCCCCGG + Intronic
1151275792 17:73033212-73033234 TGCTCACCTGCTGTGCGGCCTGG + Intronic
1153062958 18:1013013-1013035 AGTTGACCTTCTGTGCAGCCTGG - Intergenic
1156350059 18:36296093-36296115 CGCTCACCTGCTGTGTGGCCCGG - Intergenic
1157321251 18:46636340-46636362 AGCTCACCTTCTGTGCCTACAGG + Intronic
1157383805 18:47246642-47246664 CACTCGCCTTCTGGGGGGCCAGG + Intronic
1157517422 18:48320854-48320876 CCCTGACCATCTGTGCGGCCAGG + Intronic
1159542382 18:69794680-69794702 TGCTCACCTGCTCTGTGGCCTGG - Intronic
1160216977 18:76940839-76940861 CTCACCCCTGCTGTGCGGCCTGG - Intronic
1161391921 19:4025541-4025563 CCCCCACCTGCTGTGGGGCCAGG + Intronic
1161966068 19:7549894-7549916 GGCTCACGTCCTGTGCGGGCAGG - Exonic
1162018061 19:7856339-7856361 CCCTCCCCGTCTGTGCAGCCGGG - Intronic
1163727933 19:18932948-18932970 CGCTCGCGCTCTGTGGGGCCGGG + Exonic
1165952242 19:39480946-39480968 CGCTCACCTGATCTGGGGCCCGG - Exonic
1168323950 19:55528703-55528725 CTCTCTCCTTCTCTCCGGCCGGG - Intergenic
1168350961 19:55675274-55675296 CGCGCCCCTTCTGGGCGGCGGGG + Intronic
927587237 2:24318851-24318873 CGCTCACCTTCTGTGCGGCCAGG - Intronic
928154745 2:28866588-28866610 CGCTAACCTGCTGTGTGGCCCGG + Intronic
928994381 2:37271559-37271581 TGCTCACCTGCTGTGCAGCCTGG - Intronic
929184370 2:39078512-39078534 TGCTCACCTGCTCTGTGGCCTGG - Intronic
934741017 2:96722600-96722622 CATTCACCTGCTGTGCAGCCTGG + Intronic
940853211 2:158707563-158707585 TGCTCAGCTGCTGTGTGGCCCGG + Intergenic
942477626 2:176344681-176344703 CGCTCACTTGCTGTGCAGTCTGG - Intergenic
942810044 2:179988141-179988163 TGCTCACCTGCTGTGTGGCCTGG + Intronic
944111351 2:196134298-196134320 CCCCCACCTTCTATGCAGCCCGG - Exonic
948858476 2:240741586-240741608 CGCTCACGTTCTCTGTGCCCCGG + Intronic
1170505726 20:17023987-17024009 CACTCGCCTCCTGTGCGGCCCGG - Intergenic
1170684422 20:18556192-18556214 CACTCACCTGGTGTGTGGCCTGG + Intronic
1173665791 20:44762231-44762253 CGCTCACCTGCTCTGCAGCCTGG + Intronic
1173810365 20:45951694-45951716 CGCTCACCTGCTGTGTGGCCTGG + Intronic
1176104921 20:63381446-63381468 CCCTCACCTCCTGTGTGGCTCGG + Intergenic
1180000258 21:44992374-44992396 CTCTCACCAGCTGTGCGGCCTGG - Intergenic
1180050147 21:45327373-45327395 TGCTGACCTGCTGTGCAGCCAGG - Intergenic
1180288537 22:10775572-10775594 CGCTCACCTGCTGTGAGGTCTGG - Intergenic
1180843281 22:18969138-18969160 ACCTCACCTTCTGTGTGGCTGGG + Intergenic
1181058189 22:20269597-20269619 ACCTCACCTTCTGTGTGGCTGGG - Intronic
1181514730 22:23404051-23404073 ACCTCACCTTCTGTGCGACTGGG - Intergenic
1181728246 22:24826532-24826554 CGAGCACCTGCTGTGTGGCCAGG + Intronic
1182830281 22:33299533-33299555 CTGCCACCTTCTGTGCAGCCTGG - Intronic
1182898160 22:33875623-33875645 CGGTCACCTGCTTTGCGGCATGG - Intronic
1183317258 22:37143514-37143536 GACTCACCGTCTGTCCGGCCAGG + Exonic
1184656866 22:45946310-45946332 CGCTCACCTCCAGTCTGGCCTGG + Intronic
1184904395 22:47470931-47470953 CATTCACCTTCTGTGCTGCAAGG - Intronic
1184959479 22:47918601-47918623 CAGTCACCATCTGTGGGGCCAGG - Intergenic
950423316 3:12911181-12911203 GGCTCAACTGCTGTGTGGCCTGG - Intronic
950680844 3:14584111-14584133 CCCTCACCTACTGTGTGACCTGG - Intergenic
953908904 3:46882232-46882254 CGCTCCCCTTCTCCCCGGCCGGG - Intronic
954337737 3:49929626-49929648 CCGGCACCTTCTGTGCGTCCTGG - Exonic
954406908 3:50350315-50350337 AACTCACCTTCTGTGGGACCTGG + Intronic
954901663 3:54025398-54025420 CACCCACCTTCTCTGAGGCCCGG - Intergenic
955233810 3:57122423-57122445 TGCCCACCTGCTGCGCGGCCTGG - Intronic
957150945 3:76485457-76485479 CACTCACCTGCTGTGTGGCCCGG + Intronic
962946484 3:140175733-140175755 CTCTCACCTTCTGAGTGGCTTGG + Intronic
965765589 3:172126955-172126977 TGCTCAGCTTCTGTGTGTCCCGG - Intronic
966563738 3:181352435-181352457 CGCTCACCTGCTGTGCAGCCTGG + Intergenic
967325132 3:188231186-188231208 CCCTCCCCTTCAGTGTGGCCTGG - Intronic
968463464 4:737506-737528 CACTCACCTTCTTGGAGGCCTGG - Exonic
968515793 4:1015150-1015172 TGCTGGCCCTCTGTGCGGCCCGG + Intronic
968722278 4:2216474-2216496 AGCTCACCTCGTGTGCAGCCTGG - Intronic
969369599 4:6723336-6723358 GGCTCTCCTTGTGTGAGGCCAGG - Intergenic
969534500 4:7747536-7747558 CACTCAGCTTCTCTGCAGCCTGG - Intergenic
971384893 4:26133531-26133553 TGCTCACCCGCTGTGTGGCCTGG - Intergenic
973611964 4:52644450-52644472 TGCTCACCTGCTGTGCCGCTTGG - Intronic
975800853 4:78057901-78057923 CCCCCACCTTCAGTGCGCCCGGG + Exonic
976398996 4:84586604-84586626 CACTCACCTGCTCTGCAGCCGGG + Intronic
979972540 4:127154801-127154823 TGCTCACCTCCTGTGCAGCCTGG - Intergenic
981980099 4:150781510-150781532 CGCTCACCTCCTGCATGGCCTGG + Intronic
987222486 5:15804634-15804656 TGCTCACCTACTGTGCAGCTTGG - Intronic
988596296 5:32594600-32594622 CGCTCACCTCCTGTGCAGGAGGG - Intronic
990316630 5:54589161-54589183 CGGTCACCTTCTGTTCCCCCAGG + Intergenic
991430826 5:66543230-66543252 TGCTCACCTGCTGTGCAGCCTGG - Intergenic
992109398 5:73478562-73478584 CGCTCCCCTCCTGTGTGGCCCGG + Intergenic
996787149 5:127251326-127251348 CGCACAGCTACTGTGTGGCCTGG - Intergenic
997052860 5:130403104-130403126 CGCTCTCCTGGTGTGCAGCCTGG - Intergenic
997221950 5:132176553-132176575 TGCTCACCTGCTGTGCAGCCCGG - Intergenic
999408602 5:151329273-151329295 TGCTCACCTTCTGTGGGCCATGG - Intronic
1000656400 5:163884356-163884378 CACTCACCTGCTGTGTGTCCAGG + Intergenic
1001312741 5:170623135-170623157 AGCTCACCTGCTGTGCAGCCGGG + Intronic
1003344864 6:5257568-5257590 CGCTCAACTGCTGTGTGGCCCGG - Intronic
1003502229 6:6712201-6712223 CTCTCACATTCTGTGCCTCCTGG - Intergenic
1003714618 6:8632440-8632462 TGCTCACCTTCTGTGCAGCCTGG + Intergenic
1006372122 6:33651538-33651560 CCCTCACCTTCTGTGGGCCTGGG + Intronic
1008836685 6:55840944-55840966 TCCTCTCCTGCTGTGCGGCCTGG - Intronic
1008967514 6:57328068-57328090 TGCTCACCTCCTGTGCAGCCTGG + Intronic
1013765701 6:113572030-113572052 CTCACTCCTGCTGTGCGGCCAGG + Intergenic
1014350776 6:120342485-120342507 AGCTCACCTTCTGTGTGGCCTGG - Intergenic
1018045835 6:159965626-159965648 CGTTCTCCTGCTGTGCGGCCAGG - Intergenic
1019065423 6:169292145-169292167 CACTGACCTTGTGTGAGGCCGGG + Intergenic
1019453503 7:1112366-1112388 AGCTCACCTGCCCTGCGGCCCGG + Intronic
1020151710 7:5686958-5686980 TGCTCACCTCCTGTGTGGCCTGG + Intronic
1022421387 7:30226718-30226740 CCCTCACCGTGTGTGCAGCCAGG - Intergenic
1022631683 7:32091495-32091517 TGCTCACCTTCTTTGAGGCTTGG - Intronic
1023423614 7:40010721-40010743 CACTCATCTGCTGTGCGGCCTGG + Intronic
1024626607 7:51213267-51213289 TGCTCACCTGCTGTGCGACCTGG - Intronic
1027200314 7:76060075-76060097 GGATCACCTTCTGCTCGGCCGGG - Intronic
1028563714 7:92204768-92204790 TGCTCATCTGCTGTGCGGCCCGG + Intronic
1028900928 7:96099921-96099943 TGGTCAGCTTCTGTGTGGCCTGG - Intronic
1029725904 7:102404282-102404304 CGCTCACCATCTGCTCAGCCGGG - Intronic
1032615118 7:133460298-133460320 CGCTCACCTGCTGTGTGGCCTGG + Intronic
1034595769 7:152189933-152189955 TGTTCACCTACTGTGCGGCCGGG - Intronic
1034614996 7:152408495-152408517 CGCTCACCTGCTGTGTGGCCTGG - Intronic
1037096165 8:14990361-14990383 CACTCAGCTCCTATGCGGCCTGG - Intronic
1037492275 8:19407605-19407627 CTCTTACCTGCTGTGAGGCCTGG + Intronic
1037514515 8:19617291-19617313 CGTTCACCTTCTATGGGGCCTGG + Intronic
1039279633 8:35969854-35969876 TGCTCACCTGCTGTGCAGCCTGG + Intergenic
1044261872 8:90134496-90134518 CGCTCACCTGCTGTGCAGCCTGG + Intergenic
1045750311 8:105476260-105476282 CACTCACCTGCTGTGCAGCCCGG - Intronic
1046163509 8:110397812-110397834 CGCTCACCTGCTTTGTGGCCTGG + Intergenic
1048462611 8:134635090-134635112 CACTCACCTGCTGTGCAGCCTGG + Intronic
1049158901 8:141084782-141084804 CGCCCACCTTCAGCGTGGCCTGG - Intergenic
1049377635 8:142296604-142296626 CGCTCACCTTCTGTCAGGGCAGG + Intronic
1053728589 9:41028981-41029003 CACTCACCTGCTATGTGGCCTGG + Intergenic
1054699916 9:68403099-68403121 CACTCACCTGCTATGTGGCCTGG - Intronic
1055602120 9:77930872-77930894 CACTCTCTTGCTGTGCGGCCCGG - Intronic
1056803754 9:89712509-89712531 TGCTCACCTTCTGTGAGGCATGG - Intergenic
1057142848 9:92738047-92738069 GGCTCTCCTGCTGTGCCGCCGGG - Intronic
1057414630 9:94850118-94850140 GGTTCACCTGCTGTGCAGCCTGG + Intronic
1057445881 9:95114266-95114288 CCTTTCCCTTCTGTGCGGCCAGG + Intronic
1057567540 9:96178647-96178669 CGCCCACCTTTTCTGTGGCCCGG - Intergenic
1058190959 9:101915091-101915113 CACTCATCTACTGTGTGGCCTGG + Intergenic
1059663065 9:116420476-116420498 CGTTCACCCTCTGTGGGCCCTGG - Intergenic
1061034927 9:128108112-128108134 CACTTGCCTTCTGTGCAGCCAGG - Exonic
1061794059 9:133073799-133073821 CGCTCCCCAGCTGTGTGGCCTGG - Intronic
1186670094 X:11758708-11758730 ATGTCTCCTTCTGTGCGGCCTGG + Intronic
1197150248 X:123212951-123212973 GGCTCACCTGCTGTGTGTCCTGG - Intronic