ID: 927594206

View in Genome Browser
Species Human (GRCh38)
Location 2:24382623-24382645
Sequence CCATCCACACACACTTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927594206_927594212 -9 Left 927594206 2:24382623-24382645 CCTGGCAAAGTGTGTGTGGATGG No data
Right 927594212 2:24382637-24382659 TGTGGATGGCGCAGGGTGGGTGG No data
927594206_927594215 -4 Left 927594206 2:24382623-24382645 CCTGGCAAAGTGTGTGTGGATGG No data
Right 927594215 2:24382642-24382664 ATGGCGCAGGGTGGGTGGGGTGG No data
927594206_927594216 -3 Left 927594206 2:24382623-24382645 CCTGGCAAAGTGTGTGTGGATGG No data
Right 927594216 2:24382643-24382665 TGGCGCAGGGTGGGTGGGGTGGG No data
927594206_927594213 -8 Left 927594206 2:24382623-24382645 CCTGGCAAAGTGTGTGTGGATGG No data
Right 927594213 2:24382638-24382660 GTGGATGGCGCAGGGTGGGTGGG No data
927594206_927594217 -2 Left 927594206 2:24382623-24382645 CCTGGCAAAGTGTGTGTGGATGG No data
Right 927594217 2:24382644-24382666 GGCGCAGGGTGGGTGGGGTGGGG No data
927594206_927594220 29 Left 927594206 2:24382623-24382645 CCTGGCAAAGTGTGTGTGGATGG No data
Right 927594220 2:24382675-24382697 GTTGTTTTACTATTAAAGTCAGG No data
927594206_927594214 -7 Left 927594206 2:24382623-24382645 CCTGGCAAAGTGTGTGTGGATGG No data
Right 927594214 2:24382639-24382661 TGGATGGCGCAGGGTGGGTGGGG No data
927594206_927594218 -1 Left 927594206 2:24382623-24382645 CCTGGCAAAGTGTGTGTGGATGG No data
Right 927594218 2:24382645-24382667 GCGCAGGGTGGGTGGGGTGGGGG No data
927594206_927594219 0 Left 927594206 2:24382623-24382645 CCTGGCAAAGTGTGTGTGGATGG No data
Right 927594219 2:24382646-24382668 CGCAGGGTGGGTGGGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927594206 Original CRISPR CCATCCACACACACTTTGCC AGG (reversed) Intergenic
No off target data available for this crispr