ID: 927594220

View in Genome Browser
Species Human (GRCh38)
Location 2:24382675-24382697
Sequence GTTGTTTTACTATTAAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927594206_927594220 29 Left 927594206 2:24382623-24382645 CCTGGCAAAGTGTGTGTGGATGG No data
Right 927594220 2:24382675-24382697 GTTGTTTTACTATTAAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927594220 Original CRISPR GTTGTTTTACTATTAAAGTC AGG Intergenic
No off target data available for this crispr