ID: 927597640

View in Genome Browser
Species Human (GRCh38)
Location 2:24411107-24411129
Sequence TGGCAGATCCTCATTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927597638_927597640 6 Left 927597638 2:24411078-24411100 CCTCTTTCTTTCAGTGTACTTCT No data
Right 927597640 2:24411107-24411129 TGGCAGATCCTCATTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927597640 Original CRISPR TGGCAGATCCTCATTCCTAC TGG Intergenic
No off target data available for this crispr