ID: 927602597

View in Genome Browser
Species Human (GRCh38)
Location 2:24457135-24457157
Sequence ATCATCAGTGATGCATCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927602593_927602597 0 Left 927602593 2:24457112-24457134 CCAGCACCTGTCACTGGGGTGTC No data
Right 927602597 2:24457135-24457157 ATCATCAGTGATGCATCTTGGGG No data
927602594_927602597 -6 Left 927602594 2:24457118-24457140 CCTGTCACTGGGGTGTCATCATC No data
Right 927602597 2:24457135-24457157 ATCATCAGTGATGCATCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927602597 Original CRISPR ATCATCAGTGATGCATCTTG GGG Intergenic
No off target data available for this crispr