ID: 927605386

View in Genome Browser
Species Human (GRCh38)
Location 2:24482285-24482307
Sequence GAATAATGCTTGGCCCATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927605380_927605386 -2 Left 927605380 2:24482264-24482286 CCACTGCACCCCCAACACTTAGA No data
Right 927605386 2:24482285-24482307 GAATAATGCTTGGCCCATACTGG No data
927605381_927605386 -10 Left 927605381 2:24482272-24482294 CCCCCAACACTTAGAATAATGCT No data
Right 927605386 2:24482285-24482307 GAATAATGCTTGGCCCATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927605386 Original CRISPR GAATAATGCTTGGCCCATAC TGG Intergenic
No off target data available for this crispr