ID: 927605790

View in Genome Browser
Species Human (GRCh38)
Location 2:24485047-24485069
Sequence CTTTATTAGCAGAGTGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8564
Summary {0: 5, 1: 179, 2: 2034, 3: 3746, 4: 2600}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927605787_927605790 14 Left 927605787 2:24485010-24485032 CCTCTTTCTTTTGTAAATTGCCT 0: 93
1: 1744
2: 1832
3: 1958
4: 6423
Right 927605790 2:24485047-24485069 CTTTATTAGCAGAGTGAAAACGG 0: 5
1: 179
2: 2034
3: 3746
4: 2600
927605786_927605790 23 Left 927605786 2:24485001-24485023 CCAATTAAACCTCTTTCTTTTGT 0: 558
1: 591
2: 826
3: 3182
4: 6148
Right 927605790 2:24485047-24485069 CTTTATTAGCAGAGTGAAAACGG 0: 5
1: 179
2: 2034
3: 3746
4: 2600
927605788_927605790 -6 Left 927605788 2:24485030-24485052 CCTTGTCTTGAGTATGCCTTTAT No data
Right 927605790 2:24485047-24485069 CTTTATTAGCAGAGTGAAAACGG 0: 5
1: 179
2: 2034
3: 3746
4: 2600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927605790 Original CRISPR CTTTATTAGCAGAGTGAAAA CGG Intergenic
Too many off-targets to display for this crispr