ID: 927605790

View in Genome Browser
Species Human (GRCh38)
Location 2:24485047-24485069
Sequence CTTTATTAGCAGAGTGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927605786_927605790 23 Left 927605786 2:24485001-24485023 CCAATTAAACCTCTTTCTTTTGT No data
Right 927605790 2:24485047-24485069 CTTTATTAGCAGAGTGAAAACGG No data
927605788_927605790 -6 Left 927605788 2:24485030-24485052 CCTTGTCTTGAGTATGCCTTTAT No data
Right 927605790 2:24485047-24485069 CTTTATTAGCAGAGTGAAAACGG No data
927605787_927605790 14 Left 927605787 2:24485010-24485032 CCTCTTTCTTTTGTAAATTGCCT No data
Right 927605790 2:24485047-24485069 CTTTATTAGCAGAGTGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927605790 Original CRISPR CTTTATTAGCAGAGTGAAAA CGG Intergenic
No off target data available for this crispr