ID: 927607757

View in Genome Browser
Species Human (GRCh38)
Location 2:24503364-24503386
Sequence ACTGTTAAGAAGACAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 427}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927607757_927607761 8 Left 927607757 2:24503364-24503386 CCTTCCTCTGTCTTCTTAACAGT 0: 1
1: 0
2: 1
3: 43
4: 427
Right 927607761 2:24503395-24503417 CACTAATTCCTCATGTATTGAGG 0: 1
1: 0
2: 0
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927607757 Original CRISPR ACTGTTAAGAAGACAGAGGA AGG (reversed) Intronic
901161859 1:7183638-7183660 ACTGTGAAAAAGAAAGAGGATGG + Intronic
901364527 1:8734586-8734608 ACTGTTGAGCAGACCGAGGCAGG - Intronic
902489298 1:16769414-16769436 ATAGTTGAGAAGTCAGAGGAGGG - Intronic
902827574 1:18987543-18987565 AGTGCTATGAAGGCAGAGGATGG - Intergenic
904541670 1:31238072-31238094 ACAGATAAGAAGACTGAGGCCGG + Intronic
904552259 1:31328824-31328846 ACTTCTAGGAAGAAAGAGGAGGG - Intronic
905504927 1:38470633-38470655 ATTGTTAGGAAGAGAGATGATGG - Intergenic
905866622 1:41380435-41380457 CCTGTTCTGAGGACAGAGGAAGG - Intronic
905960424 1:42038023-42038045 ACTGGAGAGAAGATAGAGGATGG - Intergenic
906127423 1:43435806-43435828 ACTCTTAGGAAGACAGATCATGG - Intronic
906182000 1:43829693-43829715 ACTGTCAAGAAAAGAGAGAAAGG - Intronic
906348791 1:45039130-45039152 ACTGATAAGAAGACCCAGGCAGG - Intronic
906932556 1:50183884-50183906 ACTATTAACAAGACTGAGGGAGG - Intronic
907083360 1:51645233-51645255 AGTGTTAAGAAAATAAAGGAAGG - Intronic
907901358 1:58744298-58744320 ACTTTTAAGAAGTCACAGGGGGG + Intergenic
907918436 1:58891635-58891657 AGTGTTAAGAAGACAGAGCAGGG + Intergenic
908608192 1:65823917-65823939 ATAGTTTAGAAGACAGAGAATGG - Intronic
908900745 1:68953560-68953582 ACTGTACAGAACACAGAGGATGG + Intergenic
909050721 1:70764866-70764888 ACTTTTAAAATGACAGAGGAAGG + Intergenic
909404070 1:75266776-75266798 ACAGTGAAAAAGACAGAGAATGG + Intronic
910422746 1:87084939-87084961 ACTATTAATATGACAGAGGCCGG - Intronic
911137679 1:94458876-94458898 ACTGCTAAGAAGCTAGAAGAGGG - Intronic
912433576 1:109643092-109643114 ACTATTAAGAACACTGAGGTTGG - Intergenic
912700167 1:111872189-111872211 ACAGGTAAGAGGACAGAGGATGG + Intronic
913459323 1:119067020-119067042 ACTGTTAAGGAGGCAGACAATGG + Intronic
913465388 1:119136317-119136339 ACTGTTGAAAATATAGAGGAAGG - Intronic
914344024 1:146782781-146782803 AGTGCTAAGAAGACAGGGAAGGG - Intergenic
914903167 1:151723084-151723106 ACTTTTGAGAAGACAAGGGAGGG - Intronic
915405934 1:155659787-155659809 ACCGTTGTGAAAACAGAGGAGGG - Exonic
915419100 1:155765580-155765602 ACCGTTGTGAAAACAGAGGAGGG - Exonic
916602605 1:166307652-166307674 GCTGTTAGGCAGGCAGAGGAGGG - Intergenic
917014043 1:170509296-170509318 ACTGGTAAGGATACAGAGAAAGG + Intergenic
917253957 1:173094586-173094608 ACTGTAAAGACTAAAGAGGATGG - Intergenic
917362514 1:174192616-174192638 TCTGTTAAGAAATCAGAGGCTGG - Intronic
918432513 1:184476790-184476812 ACTGTTTTGGAGACAAAGGAAGG - Intronic
919607155 1:199698191-199698213 TCTCTTAAGAAGGCAGAGAAAGG + Intergenic
919824766 1:201495638-201495660 ACTCCTAAGAAGCCAGAGCAAGG - Intronic
920383846 1:205553195-205553217 AATGTTCAGAAGACAGAAGTTGG + Intergenic
920615449 1:207487975-207487997 AGAGTTAAGAAGAAAAAGGAAGG + Intronic
921539578 1:216397520-216397542 ACAGTAAAGCAGACAGAAGAAGG + Intronic
921982040 1:221269660-221269682 ATTGTTAATAAGACATATGATGG - Intergenic
922413517 1:225398071-225398093 AATGTAAAAAAGGCAGAGGAGGG - Intronic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
923455703 1:234163328-234163350 AGTGTTAGGGAGAAAGAGGAGGG + Intronic
923531140 1:234813111-234813133 ATAGTTGAGAAGTCAGAGGAGGG + Intergenic
923592407 1:235330182-235330204 ACTCTTAAGAAGACACAAGGCGG + Intronic
924102097 1:240614904-240614926 ACAGTTACGATGCCAGAGGATGG + Intergenic
924927105 1:248693692-248693714 AGAGTGGAGAAGACAGAGGATGG - Intergenic
924947610 1:248856792-248856814 ACTTTTAAGAAGGAGGAGGAGGG + Intronic
1062864452 10:839502-839524 ACTGCAAAGAAGAAAAAGGAAGG + Intronic
1063623794 10:7671112-7671134 AACATTAAGGAGACAGAGGAAGG + Intergenic
1063864194 10:10346196-10346218 ACACTTAAGAAAAAAGAGGAGGG + Intergenic
1065254279 10:23849858-23849880 ACTCTTAGAAGGACAGAGGAAGG - Intronic
1065901959 10:30215914-30215936 TCTGTTAAGTAGACAAAGAAAGG + Intergenic
1066034255 10:31465907-31465929 ACAGATAAGATGAAAGAGGAAGG + Intronic
1067499141 10:46786423-46786445 TCTGTAAAGATGACAGACGAGGG - Intergenic
1067595500 10:47553929-47553951 TCTGTAAAGATGACAGACGAGGG + Intergenic
1067821916 10:49538345-49538367 ACTGTTAAGTAGGCTGATGATGG + Intronic
1068586158 10:58801217-58801239 ACTATAGAGAAGACAGAGAAGGG - Intronic
1068901857 10:62278530-62278552 CCTATGAAGCAGACAGAGGAAGG - Intergenic
1070589264 10:77789947-77789969 GCTGTCAAGGAGACAGAGGCAGG + Intergenic
1072494801 10:95946303-95946325 AGTGCTAAGAAGCTAGAGGAGGG - Intergenic
1072605546 10:96979070-96979092 ACTGCTCAGAAGCCAGTGGAGGG + Intronic
1072632470 10:97155754-97155776 AAGGTTAAGAGGACATAGGAGGG + Intronic
1072868592 10:99091528-99091550 ATTTTTAAGAAAACAGAGAATGG - Intronic
1073787647 10:106907990-106908012 ACTTTTAAGATGTCAGAGAAAGG - Intronic
1074757089 10:116632131-116632153 GCTGAGAAGAAGACAAAGGAGGG + Intronic
1075117583 10:119639890-119639912 ATTGTTAAGTAAAAAGAGGAAGG + Intergenic
1075326096 10:121533276-121533298 ACTATTCAGGAGACAGAGGCAGG + Intronic
1075823255 10:125331873-125331895 ACTGTTCAGAAAACAAAGCATGG - Intergenic
1078815835 11:14822016-14822038 ACTACTCAGAAGACTGAGGAGGG - Intronic
1078983957 11:16571540-16571562 ACTGCTAAGGAGACTGAGGTGGG - Intronic
1080215603 11:29836573-29836595 ACTCTTAAGTAAACTGAGGAGGG + Intergenic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1080931452 11:36815746-36815768 CCTTATAAGAAGACAGAGAAGGG + Intergenic
1081104063 11:39042689-39042711 AATGTTATGAAGACAGAAAAAGG - Intergenic
1081178894 11:39963706-39963728 AGTATAAAGAAAACAGAGGATGG + Intergenic
1082853158 11:57783365-57783387 ACTGATAAGAAGCCATAGAAAGG + Intronic
1083796133 11:65017755-65017777 AGTGTTGGGAAGATAGAGGAGGG + Intronic
1084194161 11:67514575-67514597 ACAATTAAGTAAACAGAGGATGG + Intergenic
1085033038 11:73284116-73284138 AAGGCTTAGAAGACAGAGGAGGG + Intronic
1085413623 11:76306279-76306301 AAGGTGAGGAAGACAGAGGAGGG - Intergenic
1086451177 11:86918531-86918553 AATGCTATGAAGACAGAGAAGGG - Intronic
1088478708 11:110271451-110271473 ACTGTTGCAAAGACAGAGGAAGG - Intronic
1089967485 11:122665287-122665309 ACTGTTCAGAAGGCTGAGGCAGG - Intronic
1092035963 12:5334750-5334772 TCTTTTGAGAAGACAGAGGGAGG + Intergenic
1093081460 12:14816502-14816524 ACTGTGAAGAAGAAAGATAAAGG - Intronic
1093134876 12:15438114-15438136 ACTGTGAAGAATGCTGAGGAGGG - Intronic
1093581251 12:20786220-20786242 ACTGTATAAAAGGCAGAGGATGG + Intergenic
1093590782 12:20899626-20899648 ACTGCTAAGATTACAGAGGCTGG - Intronic
1094180080 12:27583256-27583278 AGAGTTAAGAAGACACAGGATGG + Intronic
1094422772 12:30289274-30289296 TCTGAAAAGAATACAGAGGAAGG - Intergenic
1095392851 12:41729316-41729338 ACTGTTAAGAAGATAGCAAAAGG - Intergenic
1096592359 12:52669257-52669279 ACTGTTAGGAAGAGAAAGAAAGG - Intergenic
1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG + Intronic
1098348195 12:69528181-69528203 AATGTTTAAAAGGCAGAGGAGGG + Intronic
1099623238 12:85031430-85031452 TCTGTGAAGAAGAAAGAGAATGG + Intronic
1099879190 12:88446197-88446219 ACTGTTAAGGAGACATAGAGGGG - Intergenic
1100666198 12:96756090-96756112 TCTGTGAAGGAGACAGGGGAAGG + Intronic
1100809360 12:98323472-98323494 ACTACTAGGGAGACAGAGGAAGG - Intergenic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1101353804 12:103957542-103957564 ACTCTTAAGAGGTCACAGGAGGG - Intronic
1101651471 12:106681342-106681364 AGTGATAAGAAGACAAAGCAGGG + Intronic
1101842482 12:108338170-108338192 GCTATTCTGAAGACAGAGGAGGG + Intronic
1104772843 12:131374981-131375003 AATGTTAAGAAGAATGAGGTTGG + Intergenic
1104889547 12:132133696-132133718 ACTGTCAGGAAGGCAGAGCAAGG - Intergenic
1105776323 13:23664521-23664543 ACTGTAAAGTAGTAAGAGGACGG - Intronic
1106302596 13:28482894-28482916 CCAGTTTTGAAGACAGAGGATGG + Intronic
1107420006 13:40237401-40237423 AGTCTTAGGAAGACAGTGGAAGG + Intergenic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108205581 13:48086263-48086285 ACTGGTAAGTTGACAGAGGTTGG - Exonic
1109387031 13:61643829-61643851 TCTTTAAAGAAGACAGAGAAGGG - Intergenic
1109401813 13:61841084-61841106 ACTGTTAAGAAGAGAAATAAGGG + Intergenic
1110137939 13:72091278-72091300 ACAGTTAAGAAGTCTGAGGAAGG - Intergenic
1110212219 13:72986985-72987007 ACATTTAAGATGACAGAGGCCGG - Intronic
1111477126 13:88764060-88764082 ATTGTTTTGAAGACAGAGAATGG - Intergenic
1111663439 13:91239016-91239038 ACTGTGATGCAGTCAGAGGAAGG + Intergenic
1112015497 13:95328033-95328055 TCTGTTTAGAAGCCAAAGGAGGG - Intergenic
1112740282 13:102465457-102465479 ACTGTGAGGAGGAGAGAGGAAGG + Intergenic
1113342266 13:109438184-109438206 ACAGTTACGAAACCAGAGGAAGG - Intergenic
1114146966 14:19988747-19988769 ACCATCAAGAAGACAGAGGCCGG + Intergenic
1114263983 14:21060416-21060438 ACTGGGAAGAAGCCAGGGGATGG - Intronic
1114764934 14:25360215-25360237 CCTGTGAAGAAGGTAGAGGAAGG + Intergenic
1114776529 14:25488948-25488970 ACTATGAGGAAGACAGAGAAAGG - Intergenic
1116970443 14:51059175-51059197 ACCGATCAGAAAACAGAGGAAGG + Intronic
1117249090 14:53917456-53917478 TCTGTGAAGAAGACAGAAGATGG - Intergenic
1117495955 14:56304274-56304296 CCTGTTTAGAAGACAAAAGAAGG - Intergenic
1117976900 14:61307946-61307968 ACTGTTCAGAAGGCTGAGGTGGG - Intronic
1118061095 14:62138555-62138577 ACTGATAAAAAGAAAGTGGAGGG - Intergenic
1119228326 14:72960997-72961019 ACTGCTCAGAAGACTGAGGTGGG - Intergenic
1120204271 14:81571022-81571044 ACTGATAAGTAGAGAGAGGGAGG - Intergenic
1120929824 14:89837065-89837087 GCTGCTAAGAGGCCAGAGGAGGG + Intronic
1121662139 14:95643090-95643112 ACTGTTAAGGTGACAGTGCATGG - Intergenic
1122532843 14:102440920-102440942 AGAGGTAAGAATACAGAGGAAGG + Intronic
1123428306 15:20191433-20191455 TTTGCAAAGAAGACAGAGGAAGG - Intergenic
1123435958 15:20254596-20254618 ACTATAAAGAAGTCAGTGGAAGG - Intergenic
1123705069 15:22945248-22945270 GCAGTTAGGAACACAGAGGAAGG + Intronic
1124190693 15:27574188-27574210 ACTGATACGAAAACAGAGGCAGG + Intergenic
1124695280 15:31858950-31858972 ACAGTTGAGGAGACTGAGGATGG - Intronic
1125679640 15:41522798-41522820 GGTATTAAGAAGAGAGAGGAGGG + Exonic
1126028016 15:44467141-44467163 ACAGTTCAGCAGACAGAGCAAGG - Intronic
1126292589 15:47099375-47099397 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1127077655 15:55343715-55343737 CCTTCTAAGTAGACAGAGGATGG - Intronic
1127752906 15:62063614-62063636 ACTGGAAAGAATACAGAGCAGGG - Intergenic
1128518524 15:68359973-68359995 AGTGCTGAGCAGACAGAGGAAGG + Intronic
1129433862 15:75521786-75521808 ACTTTGAAGAAGACGGATGATGG + Intronic
1130752485 15:86726990-86727012 ACAGTTAAGAAGTCAGTGGGAGG + Intronic
1130970195 15:88726364-88726386 ACTGTGAAGATCACAGAGGAGGG + Intergenic
1131085404 15:89571999-89572021 AATGTTAGGAAGCCAGGGGAAGG - Intergenic
1132740018 16:1407411-1407433 TCTGGAAAGAAGACAGAGGCCGG + Intronic
1133426366 16:5693775-5693797 ACTTATAAGAAGGGAGAGGAAGG - Intergenic
1134751211 16:16626790-16626812 ACTTTTAAGAAGCCAGATTAAGG + Intergenic
1134994243 16:18726801-18726823 ACTTTTAAGAAGCCAGATTAAGG - Intergenic
1135541042 16:23330682-23330704 ACTGTTCAGGAGGCTGAGGAGGG - Intronic
1136848641 16:33596384-33596406 ACTATAAAGAAGTCAGTGGAAGG + Intergenic
1136856012 16:33658318-33658340 TTTGCAAAGAAGACAGAGGAAGG + Intergenic
1137860120 16:51838325-51838347 GCTGCTTTGAAGACAGAGGAAGG + Intergenic
1138983317 16:62296995-62297017 GCACTTAAGAAGACAGTGGAGGG + Intergenic
1139193013 16:64886520-64886542 ACTGTTTGGAGGAGAGAGGATGG - Intergenic
1139244055 16:65423602-65423624 ACTGTTAGGAAGAGAAAGGAGGG - Intergenic
1139696248 16:68677183-68677205 ACTGTTAAGTAGAAAAAGAAAGG - Intronic
1139989972 16:70932553-70932575 AGTGCTAAGAAGACAGGGAAGGG + Intronic
1140150490 16:72358886-72358908 AGTGCTGAGAAGATAGAGGAAGG - Intergenic
1140375380 16:74441344-74441366 ACTGTCAAGAAGAAGGAGGAAGG - Intergenic
1140984277 16:80142707-80142729 ACTGGCAGGAAGACAGGGGAGGG + Intergenic
1142246292 16:88971627-88971649 ACTGTTACAAAGCCAGAGGCCGG - Intronic
1203110348 16_KI270728v1_random:1445034-1445056 ACTATAAAGAAGTCAGTGGAAGG + Intergenic
1203117598 16_KI270728v1_random:1506797-1506819 TTTGCAAAGAAGACAGAGGAAGG + Intergenic
1143850441 17:9807627-9807649 ACAGCTAAGAAGACACATGATGG + Intronic
1144135564 17:12291694-12291716 TCTGTAAAGAAGACATACGATGG - Intergenic
1144968804 17:19094222-19094244 ACTGTCAACAAGACAGATGAAGG + Exonic
1144979112 17:19157844-19157866 ACTGTCAACAAGACAGATGAAGG - Exonic
1144989110 17:19220388-19220410 ACTGTCAACAAGACAGATGAAGG + Exonic
1145279652 17:21458086-21458108 ACTGAGGAGAAGACAGAGCAGGG + Intergenic
1146102902 17:30003170-30003192 AGTGTGGAAAAGACAGAGGAAGG - Intronic
1146212510 17:30953424-30953446 ATTGTTAAGAGGACAGTGAAAGG + Intronic
1146358146 17:32152461-32152483 AGTTTTAAGAAGAGAGATGAAGG + Intronic
1146584405 17:34069802-34069824 AATGATATGAAGACAGAGGGAGG + Intronic
1148429362 17:47629478-47629500 ACTGCTTAGAAGACTGAGGTTGG + Intergenic
1150853102 17:68724660-68724682 CATGTTGAGTAGACAGAGGAGGG + Intergenic
1151855566 17:76719078-76719100 ACGGTTAAGAGAACAGTGGAGGG - Intronic
1153079987 18:1211188-1211210 AATGTTAATAGGATAGAGGAAGG - Intergenic
1155473117 18:26211151-26211173 ACTGTTAAGAAAACAACTGACGG + Intergenic
1156117421 18:33802776-33802798 TCTCAAAAGAAGACAGAGGAGGG + Intergenic
1156271417 18:35536568-35536590 AATGTGAAGGAGACAGAGGAGGG - Intergenic
1157069713 18:44391754-44391776 CCTGTGTAGTAGACAGAGGAGGG + Intergenic
1157991034 18:52496649-52496671 TCTGTTAAGGAGACAGTGGAGGG + Intronic
1158330462 18:56356771-56356793 TCAGTTAAGAAGACAGAATAGGG + Intergenic
1158405102 18:57153691-57153713 CCTCTTAAGAGGCCAGAGGATGG + Intergenic
1158537142 18:58318443-58318465 ACTGTTTAGAAGGCTGAGGTGGG + Intronic
1160197508 18:76768383-76768405 TCTCCAAAGAAGACAGAGGATGG - Intergenic
1160664205 19:315985-316007 TCTGTTGAGAAGTCAGAGGACGG - Intronic
1161054032 19:2181002-2181024 ACTGACAAGGAGACAGAGGAAGG - Intronic
1164927644 19:32142890-32142912 GATGTTAAGAAAACAAAGGAAGG - Intergenic
1165032112 19:33005478-33005500 ACTACAAAGAAGTCAGAGGAAGG - Intronic
1165307968 19:35013722-35013744 ACTGATAGGAAGAGAGAGGAGGG + Intronic
1165487134 19:36102874-36102896 ACTGTTGAGGAGCCAGAGGGTGG - Intronic
1166924447 19:46257230-46257252 ACTGTGAAGAACGCAGAGGGCGG - Intergenic
1168599459 19:57706382-57706404 AGTGTTAAGTGGACAGAGGAAGG - Intronic
925508687 2:4599623-4599645 AAAGTTAAGAAGACAGAACATGG + Intergenic
927607757 2:24503364-24503386 ACTGTTAAGAAGACAGAGGAAGG - Intronic
928129004 2:28635755-28635777 TCAGATAAGAAGACAGAAGAAGG - Intronic
929212398 2:39371764-39371786 ACTGTTAAGAAGAGCTAAGAAGG + Intronic
929988958 2:46768080-46768102 ACTATAAAGAAAACAGAGGCAGG - Intergenic
930862512 2:56089638-56089660 TCTGAAAATAAGACAGAGGAAGG - Intergenic
931183564 2:59927957-59927979 ACTGTTAAGAATGCAAAGGTGGG - Intergenic
931852280 2:66263711-66263733 ACTGTAAAGAAGTCAGTGGATGG - Intergenic
932246909 2:70203797-70203819 ACTATTAAGAAGCTAGAGGATGG + Intronic
932308615 2:70721978-70722000 ACTATTAATAAGATAGAGGAAGG + Intronic
932354834 2:71060144-71060166 ACTGGACAGAAGAAAGAGGACGG - Intergenic
932538651 2:72627107-72627129 GCTGTTATGAAGATAGAGGATGG + Intronic
933952583 2:87343110-87343132 GCTGTTAGGGAGACAGAGGTAGG + Intergenic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936781905 2:116043347-116043369 TCTGTTAAGAAGAGATAGAAAGG - Intergenic
936838613 2:116740864-116740886 ACTGTCAAGGAGACAGGGGTAGG + Intergenic
937797455 2:126040783-126040805 ACAGTATAGAAGACAGAGGATGG + Intergenic
938559445 2:132458255-132458277 ACTGGTAAGAATACAGAAGATGG - Intronic
939297621 2:140290211-140290233 AGAGTTAAGAAGACAAAGTAGGG + Intronic
939327497 2:140712531-140712553 ACTGGTTGGAAGAAAGAGGATGG - Intronic
939339193 2:140871396-140871418 ACTGTTAAGGAAACAGAGAAAGG + Intronic
939718693 2:145618985-145619007 AATGTTAAGAAGGCAGGGAATGG - Intergenic
940346884 2:152637624-152637646 ACAGGAAAGAAGACAGAGGGTGG - Exonic
940375826 2:152957517-152957539 AGTTTTAAGAAGAGAGAGAATGG - Intergenic
941012988 2:160322434-160322456 AGGGATAACAAGACAGAGGATGG + Intronic
941262166 2:163311024-163311046 AATAATAAGAAGACAGAGGGAGG + Intergenic
943113526 2:183637509-183637531 ACTGTTAGCATGACAGATGAGGG - Intergenic
944183405 2:196921968-196921990 GCTGATAAGAAAACAGAAGACGG + Intronic
944363949 2:198894050-198894072 AAATTTAAGAAGACAGAGAAGGG + Intergenic
945719123 2:213396802-213396824 ACTGTAAAGAACACAGATAAAGG - Intronic
946524118 2:220499334-220499356 ACTGTTAACAAGGCAGAGAAAGG - Intergenic
946592897 2:221271215-221271237 ACCATTAAGAGGAAAGAGGAAGG - Intergenic
947203253 2:227635596-227635618 GCAGTTAAGAAGGCAGAGGCGGG + Intergenic
947691866 2:232145721-232145743 AAAGCTAAGAAAACAGAGGATGG - Intronic
947921473 2:233878701-233878723 ACAATTAAGTAGGCAGAGGATGG - Intergenic
948233997 2:236373774-236373796 TCTATAAAGACGACAGAGGAGGG - Intronic
1168876550 20:1175993-1176015 ATTATTAAGAAGCCACAGGATGG - Intronic
1169033802 20:2433318-2433340 AATCTTAAGAAGATAAAGGAAGG + Intergenic
1169669926 20:8086648-8086670 ACTATTAATAATACAGAAGACGG - Intergenic
1171149715 20:22816598-22816620 ACTGGCTAAAAGACAGAGGAAGG + Intergenic
1171322352 20:24257615-24257637 AGTGGTGTGAAGACAGAGGAGGG + Intergenic
1171536778 20:25899218-25899240 ACAGGGCAGAAGACAGAGGAGGG + Intergenic
1171804330 20:29661939-29661961 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1171839720 20:30194483-30194505 ACAGGGCAGAAGACAGAGGAGGG + Intergenic
1172055279 20:32150470-32150492 GCTGTTGAGAAGACAAGGGAGGG + Intronic
1172757201 20:37294084-37294106 ATTTTTAAAAAGACATAGGAAGG - Intronic
1173041307 20:39465903-39465925 AGTGATAAGACGACAGAGGCAGG - Intergenic
1173125800 20:40335005-40335027 CCTGTTAAGTACACAGAGGAGGG - Intergenic
1173164276 20:40675581-40675603 ACCTTGAAGAAGACAGAGGCTGG + Intergenic
1173578561 20:44129867-44129889 TGTGTTTTGAAGACAGAGGAAGG + Intronic
1173607142 20:44339472-44339494 ACTGTTAAGGAGGATGAGGAGGG + Intronic
1173724677 20:45289094-45289116 GCTGTTAAATACACAGAGGAGGG - Intergenic
1173910786 20:46668920-46668942 ACTGTTCAGTAGACTGTGGAAGG + Intronic
1174994875 20:55555166-55555188 ACAGGCAAGAAGACAGAGAAAGG + Intergenic
1176582286 21:8543071-8543093 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1176978493 21:15351981-15352003 ACTGTCAAGAAATCAGAGGGAGG - Intergenic
1178015479 21:28341051-28341073 AATGTGAACAAGACAAAGGATGG - Intergenic
1178120652 21:29466851-29466873 AGGGTTAAGAAGAAAGAGAAAGG - Intronic
1178876820 21:36420274-36420296 ACTGTTGAGCAGACAGGGGTGGG + Intergenic
1180265121 22:10520119-10520141 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1180315068 22:11271122-11271144 ACTACTCAGAAGACAGAGGCGGG - Intergenic
1181611057 22:24012173-24012195 ACAGTTAAGTAGACAGAGTATGG - Intronic
1181779142 22:25180242-25180264 ACTTTTAAGAAGAAACAGGCAGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182789698 22:32940859-32940881 TAGGTTAAGGAGACAGAGGATGG - Intronic
1183251463 22:36733313-36733335 TCTTTTAAGAAGACAGAGTCTGG - Intergenic
1183836426 22:40457641-40457663 TCTGTCAAGAAGACAGAGCAAGG + Intronic
949361787 3:3240311-3240333 ACTGTTCAGAAGAAGGTGGAAGG + Intergenic
950388009 3:12675129-12675151 TCTGTGCAGAAGAGAGAGGAGGG - Intergenic
953458646 3:43063744-43063766 ACTGATAGGAAGACTTAGGAAGG + Intergenic
954674115 3:52306337-52306359 ACTGTCGAGATGAGAGAGGATGG + Intergenic
955093935 3:55778340-55778362 TGTGGTAAGAAAACAGAGGAAGG + Intronic
955202183 3:56861308-56861330 ACTTTGAAGAAGTCAAAGGATGG + Intronic
955499420 3:59569548-59569570 TCCTTTAAGAAGACAAAGGATGG + Intergenic
956421760 3:69093208-69093230 ACTGTTAAAAAGACAATGGTTGG + Intronic
957935997 3:86943629-86943651 ACTCTTAAGAAGAAAGAAAAAGG + Exonic
959565270 3:107826689-107826711 ACAGTGAAGGTGACAGAGGATGG - Intergenic
960418614 3:117415631-117415653 ACTGTCAAAAAGAAAGAGAAAGG - Intergenic
960745539 3:120883939-120883961 CCTATTAAGAAGAAAGAAGAGGG + Intergenic
960886939 3:122405616-122405638 ACTATTAGGCAGACTGAGGAAGG - Intronic
962269182 3:133965720-133965742 CCTGAGAAGAAGACAGAGGGAGG - Intronic
962386407 3:134936111-134936133 ACTGTTGAGAAACCAGAGAATGG + Intronic
962470495 3:135703633-135703655 ACTGTTATGAAGACAGAAGGAGG - Intergenic
962681115 3:137801426-137801448 TCTGCCAAGGAGACAGAGGAGGG + Intergenic
963426544 3:145135830-145135852 ACTGTTAAGAATATAGAGAGTGG + Intergenic
963465619 3:145677760-145677782 ACTGTAAAGAAAGCAGAAGAGGG + Intergenic
963765713 3:149334121-149334143 ACTATTAAGAAAACAAAGGTAGG + Intronic
964958046 3:162386503-162386525 TTTGTTAAGAAAACAGAGGTAGG + Intergenic
965261821 3:166496350-166496372 AGTGTGAATAAGAGAGAGGAAGG + Intergenic
965269410 3:166593629-166593651 ATTGTTAAGATGTCAGAGGCGGG - Intergenic
965887078 3:173459068-173459090 TCTGTTAAGAAGAAAGAAGAGGG + Intronic
966248233 3:177832319-177832341 ACAGTTAAGAAGAGTGACGAAGG + Intergenic
967000567 3:185330276-185330298 TCTGAGATGAAGACAGAGGAAGG - Intronic
968331342 3:197873143-197873165 AATGTGAGGAAAACAGAGGAGGG - Intronic
969273933 4:6122212-6122234 ACTGTTCAGAAGGCCGAGGCAGG + Intronic
969401030 4:6955618-6955640 TCTGTTAATGAGACAAAGGAGGG + Intronic
970153283 4:13113976-13113998 ATTGTTAAGAATGCAGAGAAAGG + Intergenic
970352780 4:15221153-15221175 ACTGATAAGAAGATATAAGATGG + Intergenic
970376498 4:15463010-15463032 ACTGTGATGCAGAGAGAGGATGG + Intergenic
972080804 4:35146477-35146499 ACTATTAATAATACAGAGAAAGG + Intergenic
972440331 4:39082847-39082869 ACTGTTAAGACCACAGAGGGTGG - Intronic
972975384 4:44628134-44628156 ACTGTGACAAAGACAGAAGAAGG + Intronic
973026503 4:45280031-45280053 ACTTTTCAGAGGCCAGAGGAAGG - Intergenic
974006503 4:56562260-56562282 ACTTTTAGGAAGAGAGAGTAGGG - Intronic
975900998 4:79152757-79152779 AGTGTTAATAAGACAATGGAAGG - Intergenic
975940777 4:79643025-79643047 ACTCAGAAGAGGACAGAGGATGG - Intergenic
976112652 4:81692464-81692486 ACTGTTAAAGAGACAGAGACAGG - Intronic
978391547 4:108231573-108231595 ACGCTTAGGAAGACAGAGGCAGG - Intergenic
978402071 4:108341583-108341605 AGTGGTAAGAAGGCAGGGGATGG + Intergenic
978542126 4:109828627-109828649 AGTCCTAAGAAGACAGAGCAGGG + Intronic
978618303 4:110616562-110616584 CCTGTTTAGATGTCAGAGGATGG + Intergenic
980598326 4:134986409-134986431 ACTGGTTAGAAGACAGGGAATGG + Intergenic
981306500 4:143252220-143252242 ACTGTTACAAATAAAGAGGAGGG + Intergenic
981320832 4:143389212-143389234 TTGGTTAAAAAGACAGAGGAAGG - Intronic
982591112 4:157312392-157312414 ACTCTAAAGAAGACAGCTGAGGG + Intronic
982710086 4:158749260-158749282 ACTTTTGAGAAAGCAGAGGATGG + Intergenic
983302164 4:165940062-165940084 ACTGATGAAAAGACAGAAGAAGG - Intronic
983708798 4:170689500-170689522 ACAGGTAACAAGAAAGAGGATGG - Intergenic
984231573 4:177106868-177106890 CTTCTTAAGAAGCCAGAGGAAGG - Intergenic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985334441 4:188876638-188876660 ACTGTTAACAAGAAAAAGAATGG - Intergenic
985410656 4:189680027-189680049 GCTTTTAAGCAGATAGAGGAAGG - Intergenic
985787060 5:1901992-1902014 ACTGATAAAAAGAGACAGGAAGG + Intergenic
986046914 5:4047299-4047321 ACTAAAAAGAAGACAAAGGAAGG + Intergenic
986385589 5:7230576-7230598 ACTATAAAGAAGTCAGGGGAGGG + Intergenic
986439315 5:7764876-7764898 AATGCAAAGAAGACGGAGGAAGG + Intronic
986502288 5:8413794-8413816 ACTTTTAGGCAAACAGAGGAAGG + Intergenic
987574940 5:19713375-19713397 GCTGTTAAGCAAACAGAGTAAGG - Intronic
987579691 5:19774300-19774322 ACTGTTCAGAAGGCAGAGGCAGG + Intronic
988443192 5:31255676-31255698 ACTATTAATAAGACAGAAGGGGG - Intronic
989088396 5:37700942-37700964 ACTGTAAAGAAGAAAGGGAAGGG - Intronic
990495511 5:56343815-56343837 ACTGATGAGAAGACTGAGGCAGG - Intergenic
990633403 5:57695764-57695786 AATGGCAAGAAGTCAGAGGAAGG + Intergenic
990879083 5:60520110-60520132 ACTTTTAAGAACACACTGGATGG + Intronic
991045833 5:62221766-62221788 TTTGCAAAGAAGACAGAGGAAGG - Intergenic
992228174 5:74639383-74639405 TCTGCAAAGAAGACAGAGAAAGG + Intronic
993553214 5:89301851-89301873 AATGTTGAGAAGTGAGAGGAAGG + Intergenic
993878533 5:93337304-93337326 AGTGTTAGGAAGACACAGGTAGG - Intergenic
993984102 5:94576056-94576078 AATGTTCAGAATACAGAGGAAGG + Intronic
994472648 5:100228150-100228172 AGTGTTAAGAAGATTGAGAAAGG - Intergenic
995229445 5:109742479-109742501 ATAGTTGAGAAGACAGTGGAAGG - Intronic
995412906 5:111878671-111878693 ACTGTTCAGAAGACAGCAAATGG + Intronic
995616861 5:113974233-113974255 CCAGTAAAGAAGACAGAGAAGGG + Intergenic
996925924 5:128826555-128826577 ATAGTTAAGAAGACAGGGGAAGG + Intronic
997027249 5:130079588-130079610 ACAGTTAAGAACACAGAGAGGGG + Intronic
997045556 5:130312649-130312671 CCTGTTAAAAAGAGGGAGGATGG - Intergenic
997376081 5:133398516-133398538 ACTGTGAAGAACGCAGAGGCAGG - Intronic
998068719 5:139179808-139179830 ACACTTCAGAAGGCAGAGGAGGG + Intronic
998193739 5:140048159-140048181 ACTCTTAGGGAGACAGAGGTGGG + Intergenic
998654361 5:144160006-144160028 ACAGTAAAGAAGACACAAGACGG - Exonic
999143970 5:149380668-149380690 AATGTGAGGAGGACAGAGGAGGG + Intronic
999247814 5:150164658-150164680 ACTGGCAAGTACACAGAGGAGGG - Intergenic
999323024 5:150626319-150626341 TCTCCTAAGGAGACAGAGGAAGG - Intronic
999674307 5:153983525-153983547 CCTGCTAAGAAGTCACAGGAAGG - Intergenic
1000505997 5:162118905-162118927 ACTCAGAGGAAGACAGAGGAAGG + Intronic
1001131530 5:169068194-169068216 TGTTTTAAGAAGACAGATGAGGG + Intronic
1001138203 5:169120424-169120446 GCTGCTTTGAAGACAGAGGAAGG + Intronic
1001426097 5:171623691-171623713 GCTGGGGAGAAGACAGAGGAGGG + Intergenic
1002100206 5:176853830-176853852 ACTGCTAGGGCGACAGAGGATGG + Intronic
1002545982 5:179945551-179945573 ACTGGTGAGAAAACAGAGGCTGG + Intronic
1002718722 5:181245449-181245471 GCTGTGAACAAGACAGAGGGGGG + Intronic
1003050452 6:2776267-2776289 ACTGTGAAGACGACTGAGCAGGG - Intronic
1003510968 6:6780027-6780049 ACTGGGAAGAAGAGAAAGGAGGG + Intergenic
1003573492 6:7271289-7271311 ACTGTTAAGAGGCAGGAGGATGG + Intronic
1004113624 6:12746101-12746123 ACTGTTACGAAGACTAAGGAAGG + Intronic
1004175827 6:13339307-13339329 ACTATTAAAAAGCCAAAGGAAGG + Intergenic
1004417032 6:15434118-15434140 ACTGTTAGGAACACAGTGAAGGG - Intronic
1005927842 6:30458949-30458971 AAAGTTAAAAAGAAAGAGGATGG + Intergenic
1007382356 6:41498991-41499013 ACTGTGAGGTAGACAGAGCAAGG + Intergenic
1008037020 6:46756201-46756223 ATTGCTAACAAGTCAGAGGAAGG - Intronic
1008404669 6:51105467-51105489 GCTTCTAAGAAAACAGAGGATGG + Intergenic
1009366190 6:62859766-62859788 ACTCTTAATATCACAGAGGAAGG + Intergenic
1010953562 6:82065356-82065378 AAAGTTAAGAAAAAAGAGGAGGG + Intergenic
1011809331 6:91112515-91112537 ACTATTAAGAAGACACAGTTGGG - Intergenic
1012205883 6:96459636-96459658 TCTGTAAAGACGACAGAGGTTGG + Intergenic
1012756280 6:103235572-103235594 ACTCTTATGAATACATAGGATGG - Intergenic
1013803598 6:113972411-113972433 CTTGTTAAAAATACAGAGGAGGG - Intronic
1014936652 6:127393473-127393495 ATTGTTAAGAATGCAAAGGAAGG - Intergenic
1015278721 6:131409293-131409315 ACTTGTAAGAAGACAAAGAAAGG - Intergenic
1015593179 6:134842047-134842069 AATGTTAAGAAGAAAAAAGAAGG - Intergenic
1016261665 6:142178651-142178673 ACTCTAAAGAAGGCAGAGAAGGG + Intronic
1017267315 6:152462890-152462912 ACTGTTAAGGAAAGGGAGGAGGG + Exonic
1017488028 6:154920917-154920939 ACTGATAAGGACAGAGAGGAGGG - Intronic
1017831557 6:158135117-158135139 AATGTCATGAAGACAGAGAAAGG + Intronic
1017889077 6:158624645-158624667 ACAGATAAGAAAACAGAGGTCGG + Intronic
1018455001 6:163943943-163943965 AGATTTAAAAAGACAGAGGAAGG - Intergenic
1018459242 6:163981693-163981715 ACTGTCACCAAGACAGTGGATGG - Intergenic
1020673332 7:11147668-11147690 TCAGTTAAGAAGACTGAGAAGGG - Intronic
1021150719 7:17147737-17147759 ACTGTGGAGAAAATAGAGGAAGG - Intergenic
1021956529 7:25830545-25830567 AGTTTTAAGAAGATAGAGGGAGG - Intergenic
1022575894 7:31496662-31496684 ACTGTTAAAAAAAGATAGGAAGG + Intergenic
1023042471 7:36183798-36183820 ACTGTCAAGAATACAGAGTCTGG - Intronic
1023172408 7:37402471-37402493 ACACTTAGGAAGAAAGAGGAAGG - Intronic
1023374447 7:39541984-39542006 ACTGCTTAGGAGACAAAGGAGGG - Intergenic
1023568011 7:41542631-41542653 AGTATTCAGAGGACAGAGGATGG - Intergenic
1023774041 7:43585923-43585945 ACTGTTCAGAAGTCTCAGGAAGG + Intronic
1024601042 7:50982015-50982037 ACTGTCAAACAGGCAGAGGATGG - Intergenic
1025288246 7:57685925-57685947 ACAGGTCAGAAGACAGAGGAGGG + Intergenic
1026373236 7:69723024-69723046 ACTGTTCAGAAGCAAGAGGGAGG + Intronic
1027998458 7:85458311-85458333 AATATTATTAAGACAGAGGATGG - Intergenic
1028785684 7:94790518-94790540 ACTATTCAAAAAACAGAGGAGGG - Intergenic
1029222645 7:99002654-99002676 ACTGTGAGGAATGCAGAGGAGGG + Intronic
1029261359 7:99304882-99304904 ACTGTTAAGAAGAAATTGAAAGG + Intergenic
1030415949 7:109242778-109242800 ACTATAAAGAAAACAGGGGAAGG + Intergenic
1031133825 7:117863638-117863660 ACAGATGAGAAAACAGAGGATGG - Intronic
1031571197 7:123362198-123362220 ACTGATTAGAAGACAAGGGAAGG + Intergenic
1031680171 7:124663602-124663624 ACTGTTAAGAAGACAGATTCTGG - Intergenic
1032885467 7:136133589-136133611 GCAAATAAGAAGACAGAGGAGGG - Intergenic
1033081492 7:138302781-138302803 AATGTTCATAAGAAAGAGGATGG - Intergenic
1033229598 7:139586112-139586134 ATTGTTAAGAACTCAGAAGAAGG + Intronic
1033644338 7:143288884-143288906 ATTTTTAAGGAGACAGAGTATGG - Intronic
1036147277 8:6266004-6266026 ACAGATAAGAAAACAGAGGGGGG + Intergenic
1037332862 8:17761822-17761844 ACTTTTAAGAAGACTGATAATGG - Intronic
1037781511 8:21872434-21872456 ACTGTTTGGGAAACAGAGGAAGG - Intergenic
1038041000 8:23724170-23724192 GCTATTCAGAAGACTGAGGAGGG - Intergenic
1041131568 8:54707622-54707644 ACTGGTAAGAAGGGAGAGGGCGG - Intergenic
1041271321 8:56111976-56111998 ACTGTTAAGGAGGGAGAGGCAGG - Intergenic
1042875207 8:73435206-73435228 ACTGTTAGGAACCCAGAGGGAGG - Intronic
1043091700 8:75912729-75912751 AAACTTAAGAAGAAAGAGGAAGG + Intergenic
1044964805 8:97564516-97564538 ACTGTTAATAAGTAATAGGATGG - Intergenic
1045832671 8:106482718-106482740 ACAGTTAATAAGATAGATGAAGG - Intronic
1046148408 8:110191596-110191618 ACTTTAAAGAATAAAGAGGAGGG - Intergenic
1046154748 8:110273311-110273333 CCTGTTAAGAAGACATATTAAGG + Intergenic
1046595988 8:116261729-116261751 ACTGCAAAGGAGACTGAGGAAGG + Intergenic
1046910127 8:119617432-119617454 ACAGATAAGAACACAGAGTATGG + Intronic
1046981309 8:120339289-120339311 ACTGTAAAAAAGACAGAAGATGG - Intronic
1047305383 8:123649003-123649025 AGGATTAAGAAGACAGAGAAGGG - Intronic
1047875802 8:129136375-129136397 AATGTTAAGCAGACATAAGATGG + Intergenic
1048308515 8:133300172-133300194 ATAGGTCAGAAGACAGAGGAAGG + Intronic
1048776492 8:137952545-137952567 AGAATTAAGAAGACAGAGGCCGG - Intergenic
1050223135 9:3419458-3419480 AGTGTCAAAAAGACAGAGCATGG - Intronic
1050472777 9:6009068-6009090 TCTGTTAAGAATAAAGAGAATGG + Intergenic
1050704306 9:8379631-8379653 TCTCTTAAGAAGACCGAGTAGGG - Intronic
1052359551 9:27539552-27539574 ACTGTCATGAAGCCAGAGGAAGG - Intergenic
1052401957 9:28011839-28011861 ACAGTCAAGAAGACACAGGCAGG + Intronic
1052457384 9:28717707-28717729 ACTAGTAAGAAGAGACAGGAGGG - Intergenic
1052527210 9:29633362-29633384 ACTGTTAATAAACCATAGGATGG + Intergenic
1052731355 9:32290645-32290667 CCTGTTAATATGACAGAGCAAGG - Intergenic
1055162745 9:73151285-73151307 ACTCTTAGGGAGACAGAGGCAGG + Intergenic
1055552498 9:77444644-77444666 GCTGTGAAGAAGACACTGGAAGG - Intronic
1056905007 9:90638897-90638919 AGTGTAAGGATGACAGAGGAAGG + Intronic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057863765 9:98663149-98663171 ACTGTCATCAAGACAGTGGAGGG + Intronic
1059832915 9:118118517-118118539 ACTGTTACGAAGCCAGAGATGGG - Intergenic
1059980995 9:119771864-119771886 TTTGTGAAGAAAACAGAGGAAGG - Intergenic
1060563766 9:124570502-124570524 ACAGTTGAGAAGTCAGATGATGG - Intronic
1061386039 9:130289874-130289896 ACAGATGAGAACACAGAGGATGG - Intronic
1061603254 9:131687064-131687086 ATTGTCAAGAAGCCAGAGGCTGG - Intronic
1203363352 Un_KI270442v1:237034-237056 ACTACTCAGAAGACAGAGGCGGG - Intergenic
1203612304 Un_KI270749v1:21085-21107 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1203672106 Un_KI270755v1:25399-25421 GCTTTTAAGCAGATAGAGGAAGG + Intergenic
1186150375 X:6668494-6668516 ACTGGAAAGAACACAGAGGCTGG - Intergenic
1187500359 X:19833648-19833670 ACTGTGGGGAAGAGAGAGGAGGG - Intronic
1189078593 X:37944212-37944234 AATATTAAGAATACATAGGATGG - Intronic
1189452966 X:41156688-41156710 ACTGTTCAGGAGATAGAGGGAGG - Intronic
1189537206 X:41947694-41947716 TGTTTTAAGAAAACAGAGGATGG + Intergenic
1189601776 X:42634619-42634641 ACATTTAAGAAGTCAGTGGAAGG - Intergenic
1189971633 X:46423545-46423567 ATTGTCATGAAGACAGATGATGG - Intergenic
1190326963 X:49212466-49212488 AGTGTTAAGTAGATAGAGTAAGG + Intronic
1192262015 X:69511180-69511202 ACTGTTGAGAGGAAAGAGGTGGG - Intronic
1192587619 X:72331898-72331920 ACTGTAAAGGAGGTAGAGGAGGG - Intronic
1192759678 X:74084272-74084294 ACTGTAGAGAACACAGAAGAGGG + Intergenic
1193008232 X:76644632-76644654 ACTGTTGGAAAGGCAGAGGATGG + Intergenic
1193912372 X:87321683-87321705 ACTATTTAGGAGACAGACGAAGG - Intergenic
1194401890 X:93447640-93447662 ACTGCATAGAAGAGAGAGGAAGG - Intergenic
1196097509 X:111815835-111815857 TCTGTTGACAAGACACAGGACGG + Intronic
1197516462 X:127436463-127436485 ACTGTTAAACAGAAAGAGGAAGG + Intergenic
1197777899 X:130131796-130131818 ACTCCTAAGAAGAGAGAAGAGGG + Exonic
1198207619 X:134482909-134482931 ACAGTTAAAAGGACAGAGAATGG + Intronic
1200776064 Y:7171359-7171381 ACTAAAAAGAGGACAGAGGAAGG - Intergenic
1201145149 Y:11060463-11060485 ACTGGGAAGAAGTCACAGGAGGG + Intergenic
1201935875 Y:19410663-19410685 ATTATTAAGAAGCCAGGGGAGGG + Intergenic
1202590539 Y:26478767-26478789 ATTGTAAAGGAGACAGAGTATGG - Intergenic