ID: 927610243

View in Genome Browser
Species Human (GRCh38)
Location 2:24531680-24531702
Sequence GTATGTTCTCATTCACAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32328
Summary {0: 1, 1: 35, 2: 1035, 3: 10674, 4: 20583}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927610243_927610250 22 Left 927610243 2:24531680-24531702 CCCACCTGTGAATGAGAACATAC 0: 1
1: 35
2: 1035
3: 10674
4: 20583
Right 927610250 2:24531725-24531747 TGATAGTTTGCTGAGAATGATGG 0: 3456
1: 11192
2: 10129
3: 4750
4: 3607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927610243 Original CRISPR GTATGTTCTCATTCACAGGT GGG (reversed) Intronic