ID: 927610244

View in Genome Browser
Species Human (GRCh38)
Location 2:24531681-24531703
Sequence CGTATGTTCTCATTCACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26297
Summary {0: 1, 1: 20, 2: 632, 3: 7318, 4: 18326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927610244_927610250 21 Left 927610244 2:24531681-24531703 CCACCTGTGAATGAGAACATACG 0: 1
1: 20
2: 632
3: 7318
4: 18326
Right 927610250 2:24531725-24531747 TGATAGTTTGCTGAGAATGATGG 0: 3456
1: 11192
2: 10129
3: 4750
4: 3607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927610244 Original CRISPR CGTATGTTCTCATTCACAGG TGG (reversed) Intronic