ID: 927610244 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:24531681-24531703 |
| Sequence | CGTATGTTCTCATTCACAGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 26297 | |||
| Summary | {0: 1, 1: 20, 2: 632, 3: 7318, 4: 18326} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 927610244_927610250 | 21 | Left | 927610244 | 2:24531681-24531703 | CCACCTGTGAATGAGAACATACG | 0: 1 1: 20 2: 632 3: 7318 4: 18326 |
||
| Right | 927610250 | 2:24531725-24531747 | TGATAGTTTGCTGAGAATGATGG | 0: 3456 1: 11192 2: 10129 3: 4750 4: 3607 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 927610244 | Original CRISPR | CGTATGTTCTCATTCACAGG TGG (reversed) | Intronic | ||