ID: 927610246

View in Genome Browser
Species Human (GRCh38)
Location 2:24531684-24531706
Sequence CACCGTATGTTCTCATTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20722
Summary {0: 1, 1: 17, 2: 572, 3: 6443, 4: 13689}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927610246_927610250 18 Left 927610246 2:24531684-24531706 CCTGTGAATGAGAACATACGGTG 0: 1
1: 17
2: 572
3: 6443
4: 13689
Right 927610250 2:24531725-24531747 TGATAGTTTGCTGAGAATGATGG 0: 3456
1: 11192
2: 10129
3: 4750
4: 3607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927610246 Original CRISPR CACCGTATGTTCTCATTCAC AGG (reversed) Intronic